ID: 914334018

View in Genome Browser
Species Human (GRCh38)
Location 1:146698937-146698959
Sequence CATTACATGCAGATGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914334018_914334026 6 Left 914334018 1:146698937-146698959 CCCTCCCACATCTGCATGTAATG No data
Right 914334026 1:146698966-146698988 CTGGCATGAAGTGCCGGGGCTGG No data
914334018_914334025 2 Left 914334018 1:146698937-146698959 CCCTCCCACATCTGCATGTAATG No data
Right 914334025 1:146698962-146698984 AAAGCTGGCATGAAGTGCCGGGG No data
914334018_914334024 1 Left 914334018 1:146698937-146698959 CCCTCCCACATCTGCATGTAATG No data
Right 914334024 1:146698961-146698983 GAAAGCTGGCATGAAGTGCCGGG No data
914334018_914334023 0 Left 914334018 1:146698937-146698959 CCCTCCCACATCTGCATGTAATG No data
Right 914334023 1:146698960-146698982 AGAAAGCTGGCATGAAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914334018 Original CRISPR CATTACATGCAGATGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr