ID: 914336993

View in Genome Browser
Species Human (GRCh38)
Location 1:146724557-146724579
Sequence GTGGCAGCACAGCTCATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914336984_914336993 28 Left 914336984 1:146724506-146724528 CCAGCTGGTACAGTTGCTTTTCC 0: 1
1: 1
2: 0
3: 14
4: 129
Right 914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG 0: 2
1: 0
2: 1
3: 15
4: 194
914336990_914336993 -3 Left 914336990 1:146724537-146724559 CCTCTGCTCAGAGAACTTGAGTG 0: 2
1: 0
2: 2
3: 21
4: 244
Right 914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG 0: 2
1: 0
2: 1
3: 15
4: 194
914336987_914336993 7 Left 914336987 1:146724527-146724549 CCCCTGGGTTCCTCTGCTCAGAG 0: 2
1: 0
2: 7
3: 29
4: 289
Right 914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG 0: 2
1: 0
2: 1
3: 15
4: 194
914336989_914336993 5 Left 914336989 1:146724529-146724551 CCTGGGTTCCTCTGCTCAGAGAA 0: 2
1: 0
2: 1
3: 24
4: 290
Right 914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG 0: 2
1: 0
2: 1
3: 15
4: 194
914336988_914336993 6 Left 914336988 1:146724528-146724550 CCCTGGGTTCCTCTGCTCAGAGA 0: 2
1: 0
2: 1
3: 32
4: 230
Right 914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG 0: 2
1: 0
2: 1
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914336993 Original CRISPR GTGGCAGCACAGCTCATTGG TGG Intergenic
900158856 1:1213996-1214018 GTGGCAGCACCGGTCGTTGCTGG + Exonic
900902882 1:5528607-5528629 GAGGCAGCACTGCTTTTTGGAGG + Intergenic
902306148 1:15540933-15540955 GGGGCAGAACTGGTCATTGGAGG + Intronic
903015371 1:20358161-20358183 GTGGCAGCTCAGGTCAGTGAAGG - Intergenic
905017897 1:34790081-34790103 ATGGCATCACAGCACATAGGAGG + Intronic
905057525 1:35108770-35108792 GTGTGAGCAAAGCTCACTGGAGG + Intronic
905766058 1:40602123-40602145 GTGGCAGCAGAGAGCAATGGAGG - Intergenic
907504004 1:54903941-54903963 TTGGCAGGACAGCTCCTTGAGGG + Intergenic
908327301 1:63035785-63035807 CAGGCAGCACTGCTCATTGGTGG + Intergenic
911099936 1:94087565-94087587 GAGGCAGCACAGGTGTTTGGAGG + Intronic
913594792 1:120364838-120364860 GGGGCAGAACAGCTCATGAGGGG - Intergenic
914092475 1:144514148-144514170 GGGGCAGAACAGCTCATGAGGGG + Intergenic
914306055 1:146419727-146419749 GGGGCAGAACAGCTCATGAGGGG - Intergenic
914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG + Intergenic
914595997 1:149153086-149153108 GGGGCAGAACAGCTCATGAGGGG + Intergenic
916407409 1:164511021-164511043 GTGGCAGCAGAGCGCATTCTGGG - Intergenic
917969502 1:180197784-180197806 GAGGGAGCAGAGCTCAATGGGGG - Exonic
920009267 1:202855951-202855973 GTGGCAGCAGAGATCATAGATGG + Intergenic
920221165 1:204402467-204402489 GTGGAATCACAGCTCACTGCAGG + Intergenic
920797982 1:209159021-209159043 GTGGCAAGACAGCTCATCAGAGG - Intergenic
922865152 1:228853538-228853560 GTGGAAGCACAGCTCTGTGCAGG + Intergenic
1063102266 10:2961097-2961119 CTGACAGCTCAGCTCCTTGGTGG - Intergenic
1063615120 10:7593912-7593934 TTGGCTGCTCAGCCCATTGGAGG - Intronic
1066458983 10:35596792-35596814 GTGGCAGCACCCCTGAATGGAGG - Intergenic
1067175635 10:43943618-43943640 GCGGCAGCTCAGCTCAGGGGGGG - Intergenic
1067267615 10:44759456-44759478 GTGGAAGAGCAACTCATTGGAGG - Intergenic
1068363458 10:56012171-56012193 GTGACAGCACAGGCCATGGGAGG - Intergenic
1069841804 10:71344467-71344489 GTGACAGCCCAGCTCCCTGGGGG - Intronic
1072961849 10:99936574-99936596 GTGCCATCACAGCTCACTGCAGG + Intronic
1074990030 10:118696868-118696890 GTGGGAGCAAGGCTAATTGGAGG - Intronic
1076024383 10:127100233-127100255 GTGGCAGCAAAGCCAATGGGAGG + Intronic
1077367277 11:2166288-2166310 GTGGCAGCACAGGCCGTGGGAGG + Intronic
1081553304 11:44134077-44134099 GTGGCAGCACTGCTCACTGGTGG - Intronic
1081712463 11:45226193-45226215 GTGGCACCACATCTCATTGAGGG - Intronic
1082090783 11:48088088-48088110 GTCCCAGCACAGGTCTTTGGAGG + Intronic
1083802888 11:65057192-65057214 GAGGCCACACAGCCCATTGGTGG + Intronic
1084067016 11:66710537-66710559 GTGGGAGCACAGCTCAGGGAAGG + Intronic
1085100659 11:73797222-73797244 GTGGCAGAATAGCTCAGAGGAGG - Intronic
1087296909 11:96388906-96388928 GTGGCAGCACAGTTCCTAGCAGG - Intronic
1089036426 11:115398155-115398177 GTGGCACAACACATCATTGGGGG + Intronic
1089202792 11:116734640-116734662 GAGCCACCACAGCTCATTCGTGG - Intergenic
1089307326 11:117534867-117534889 CTGGCATCCCAGCTCTTTGGAGG - Intronic
1089511948 11:119004699-119004721 GTGGGATCACAGCTCACTGCAGG - Intronic
1090133223 11:124167868-124167890 GTGGCAGCACTGCTCATATGGGG + Intergenic
1091212470 11:133873931-133873953 GTGGCACCACAGCTCTTCTGTGG + Intergenic
1092052854 12:5484868-5484890 GTGGCCACAAAGCTCATTAGTGG + Intronic
1093369716 12:18352912-18352934 GTGGCAGAGCAGCTGAGTGGTGG - Intronic
1096229906 12:49890966-49890988 AGGGCTGCACAGCTCACTGGTGG + Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1100620641 12:96269107-96269129 ATGGCTGCACAGCTCACTGAAGG + Exonic
1100782003 12:98037098-98037120 GTAGCAGCACAAATCATTTGTGG + Intergenic
1102037604 12:109781192-109781214 GTGGCAGGTCAGCTCTCTGGAGG - Intergenic
1102144790 12:110646604-110646626 GGGGCAGCTCAGCTCCTTCGTGG + Intronic
1102556728 12:113731668-113731690 GTGGCAGCACTGGTCATCTGAGG - Intergenic
1103662546 12:122532868-122532890 GTGGCTGGAGAGCTCATTGTCGG + Intronic
1107287303 13:38808603-38808625 ATGGGAGAACAGCTGATTGGTGG + Intronic
1107571079 13:41658774-41658796 GTGGAAGCAGAGAGCATTGGTGG + Intronic
1108337264 13:49457690-49457712 GTGCCACCACACCTCATGGGAGG - Intronic
1108421346 13:50252928-50252950 ATGTCATCTCAGCTCATTGGTGG + Intronic
1108757280 13:53518969-53518991 GTCCTAGCACAGCTCTTTGGAGG + Intergenic
1112229592 13:97575102-97575124 GAGGCAGCGCAGCCCAGTGGTGG + Intergenic
1113661481 13:112108970-112108992 GTGGCAGGACTTCTCATGGGAGG + Intergenic
1115701437 14:35956990-35957012 GGGGCAGCACAGCTGATTTGAGG + Intergenic
1117945897 14:61020538-61020560 ATGGCAGCACAATTCACTGGTGG - Intronic
1119684834 14:76623319-76623341 GTGGCAGCACAGCTCTTGCCAGG - Intergenic
1120232562 14:81856096-81856118 GTGGCAGCAGAGCTCACAGCTGG - Intergenic
1121165294 14:91790803-91790825 GTTACAGAACAGCACATTGGGGG + Intronic
1123031005 14:105451041-105451063 GTGGCAGCAGAGCCCGTGGGAGG - Intronic
1124048265 15:26171404-26171426 GTGGCATCACAGGTTATCGGAGG + Intergenic
1124150065 15:27169373-27169395 GGGGAAGCACCGCCCATTGGAGG + Intronic
1124213991 15:27791460-27791482 GTGGGAGAACAGCTCAGTGGTGG + Intronic
1124823560 15:33071066-33071088 GTTTCAGCCCAGTTCATTGGTGG + Intronic
1125836760 15:42758952-42758974 GTGGCAGCTTGGCTCATGGGTGG - Intronic
1128736422 15:70056396-70056418 GTGGCAGCACGGCTGATGGAGGG - Intronic
1130845732 15:87743345-87743367 GTGGCAAGACAGCTCTCTGGAGG - Intergenic
1131637630 15:94253874-94253896 GTGGTAGTATAGCTCAATGGTGG + Intronic
1132749335 16:1450285-1450307 GTGGCAGCGCAGCCCATGTGTGG - Intronic
1132787758 16:1667449-1667471 GTGGCAGCTCAGGGCACTGGAGG - Intronic
1132815443 16:1824016-1824038 GTGGCAGCACAGCTTGCTGGAGG - Intronic
1133492433 16:6283263-6283285 GTGCCATCACAGCTCACTGTAGG - Intronic
1138185439 16:54973032-54973054 GTGAGAGCACATCTGATTGGTGG + Intergenic
1139997276 16:70992762-70992784 GTGGCAGCACAGCTCATTGGTGG - Intronic
1141696103 16:85620226-85620248 GTGCGATCACAGCTCATTGCAGG - Intronic
1144481758 17:15635724-15635746 GAGGAAGCACAGCTGATTTGGGG - Intronic
1144916542 17:18728048-18728070 GAGGAAGCACAGCTGATTTGGGG + Intronic
1145246270 17:21271941-21271963 TTGGCCGCACTGCTCATGGGAGG + Intergenic
1145402926 17:22558208-22558230 GTGGCAACACATCGCAGTGGAGG - Intergenic
1146692455 17:34885955-34885977 GTGCCATCACAGCTCACTGTAGG - Intergenic
1146831129 17:36070453-36070475 GAGGCAGCAGAGCTCTTTGTTGG - Exonic
1147571238 17:41572284-41572306 GTGGCAGTACAGCTGATTTATGG - Intergenic
1153814961 18:8783921-8783943 GTGGCGGCGGAGCTCAGTGGAGG - Exonic
1153992176 18:10410330-10410352 GCTGCAGCACAGCTCATAGTGGG - Intergenic
1155609912 18:27654925-27654947 AAGGCAGCACAGCTCACTAGAGG + Intergenic
1155727269 18:29103148-29103170 AAGGCAGCACAGCCAATTGGTGG + Intergenic
1155877415 18:31103468-31103490 GAGACAGAACAGCTCATTAGTGG - Intergenic
1160006856 18:75074501-75074523 GTGGAAGGAGACCTCATTGGAGG - Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1162927168 19:13936416-13936438 GAGGCGGGACAGCTCATTGTAGG + Exonic
1165657092 19:37543520-37543542 CAGGCAGCAGAGATCATTGGGGG + Intronic
1165815139 19:38637210-38637232 GTGGCAGCCCAGCCCTGTGGTGG + Intergenic
1165842918 19:38799529-38799551 GTGTGATCACAGCTCATTGCAGG - Intergenic
1168454275 19:56493880-56493902 GTGGTGGCACAGCTACTTGGTGG - Intergenic
925345167 2:3167063-3167085 GCTGCAGCACAGCTCATTGATGG + Intergenic
925603489 2:5634184-5634206 GGGGCAGAACAGCTCATGAGGGG - Intergenic
926006367 2:9376209-9376231 GCGGCAGCACAGCTCAGTGCTGG - Intronic
926109331 2:10172038-10172060 GGGGAAGCACAGCTCCTTTGGGG + Intronic
926661493 2:15472133-15472155 GTGGTAGCATATCTCATTTGTGG + Intronic
928218822 2:29385448-29385470 GTGTGATCACAGCTCATTGCAGG + Intronic
929592065 2:43153907-43153929 GTGGCCGCAGAGCCCATGGGTGG + Intergenic
934219051 2:90064807-90064829 GTGGCAGCATGACTCATAGGGGG + Intergenic
934969001 2:98748094-98748116 GAGGCTGCAAAGCACATTGGGGG - Intergenic
936705911 2:115073417-115073439 GTGGCAGCAGGGCACAGTGGAGG + Intronic
942456208 2:176140296-176140318 ATGCCAGCACAGCACATTCGAGG + Intergenic
943804860 2:192111714-192111736 GTGGCAGCCCCTCTCATTGCAGG + Intronic
945100031 2:206255243-206255265 GTGGGATCACAGCTCATTATAGG + Intergenic
945878791 2:215305581-215305603 GTGGCAGCAGTGGACATTGGAGG - Intergenic
1169415904 20:5416029-5416051 GTTGCAGCCCAGATCCTTGGAGG - Intergenic
1174702551 20:52623822-52623844 GTGTGATCACAGCTCATTGCAGG - Intergenic
1174896392 20:54454013-54454035 GTGGCAAGACAGGTCATGGGAGG - Intergenic
1175946701 20:62562289-62562311 GAGGCAGCACAGCTCAGTTTGGG + Intronic
1177669712 21:24209108-24209130 GGGGCCCCACAGCTCAGTGGCGG + Intergenic
1177800735 21:25826153-25826175 GTGCCATCACAGCTCACTGCAGG + Intergenic
1179136842 21:38687230-38687252 GAGGCAGCACTGCTCATCTGAGG + Intergenic
1182455600 22:30448293-30448315 GTGGCTTCAGATCTCATTGGGGG - Intronic
1182791215 22:32954629-32954651 GTGGAAGCACAGTCCATTGTTGG + Intronic
1183170777 22:36186279-36186301 GTGGCAGCAATGGTCAGTGGTGG + Intergenic
1184445493 22:44544654-44544676 GTGTCAGCAGAGCTCAGCGGAGG - Intergenic
1184582086 22:45424709-45424731 GTGGCAGTACTGCTCCTGGGAGG - Intronic
1185372104 22:50465692-50465714 GTGGCAGCAGACCTGAGTGGGGG + Intronic
949484018 3:4520078-4520100 GAGGCAGCACAGATGAATGGAGG + Intronic
949499605 3:4666995-4667017 TTAGCAGCACAGATCACTGGGGG + Intronic
952972399 3:38659884-38659906 ATGCCAGCACATCTAATTGGTGG - Intergenic
954245177 3:49325741-49325763 ATGGCAACTCAGCACATTGGTGG + Exonic
954919300 3:54175775-54175797 TTGGCAAAACAGGTCATTGGAGG + Intronic
954964219 3:54596357-54596379 GTGGAAGCACAGCTGCTTAGAGG + Intronic
957682960 3:83461537-83461559 GTAGTAGCACAGCTGTTTGGGGG - Intergenic
959769262 3:110072734-110072756 GGAGCTGCCCAGCTCATTGGGGG + Intergenic
962706355 3:138048634-138048656 GTGGCAGCACCACTCACTTGTGG + Intergenic
967750871 3:193114927-193114949 GTGGCAGGACAGGTTATGGGAGG + Intergenic
968104811 3:195993366-195993388 GTGCCTGCACTTCTCATTGGTGG - Intergenic
968124317 3:196147173-196147195 CTGGCAGCACAGTTTATGGGAGG + Intergenic
968596487 4:1488725-1488747 GTGCCATCACAGCTCACTGCAGG + Intergenic
968986900 4:3880524-3880546 TGGGCAGAACAGCTCCTTGGGGG - Intergenic
969525199 4:7700738-7700760 GAGGGAGCACAGAGCATTGGGGG + Intronic
970459748 4:16261674-16261696 GTGTCAGTACGGCTCTTTGGTGG + Intergenic
971254763 4:25004193-25004215 GTGGTAGCCCAGCTCTTCGGTGG - Exonic
972631124 4:40842878-40842900 GAGGCAGCACAGGTCAAGGGCGG + Intronic
974616486 4:64290211-64290233 GTGGCAGCACTGCTCACAGTAGG - Intronic
975587718 4:75967265-75967287 GTGGCAGCTTACCTCTTTGGTGG + Exonic
976005084 4:80420079-80420101 GTGGCAGAATAGATCATGGGAGG + Intronic
976741655 4:88363050-88363072 GTGGCAAGACAGGTCATGGGAGG + Intergenic
977994096 4:103481897-103481919 ATGGCACCACAGCTCAGTGCTGG + Intergenic
978489939 4:109302120-109302142 GTGGCTGCACAACTAGTTGGTGG + Intronic
984141236 4:176005864-176005886 GTGGCAAGACAGCTTATGGGAGG + Intergenic
984144405 4:176043946-176043968 GAGGCAACACAGCTGGTTGGGGG + Intergenic
984376959 4:178943988-178944010 GTTCCAGCTCAGGTCATTGGGGG + Intergenic
986343252 5:6810956-6810978 GAGGCTGCACAGGTCATTGGAGG - Intergenic
989026300 5:37072370-37072392 GGTGCAGCACAGCTCATAGTAGG - Intergenic
990468419 5:56090790-56090812 GTGGCAGCCCACCTCTCTGGGGG + Intergenic
990546987 5:56832562-56832584 GTGGTAGCACAGCTAGTGGGTGG + Intronic
990853020 5:60228504-60228526 TGGGAAGCACAGCTCATTGGGGG - Intronic
992821523 5:80502136-80502158 GTGTAATCACAGCTCATTGCAGG + Intronic
992882016 5:81119688-81119710 GTGGCAGCACTGATCATTCATGG + Intronic
994194253 5:96904538-96904560 TTGGAGGCATAGCTCATTGGAGG + Intronic
994970545 5:106731183-106731205 GTGACAGCATAGCTCAGTGGGGG - Intergenic
995479558 5:112581002-112581024 ATGGCAGCACAGCACAATGTAGG + Intergenic
997071901 5:130632736-130632758 GAACCAGCACAGCTCAGTGGTGG - Intergenic
1001797017 5:174510842-174510864 GTGGCTGCACAGCTTATTGAGGG + Intergenic
1001820482 5:174706257-174706279 GTGTCATCACAGCTCACTGCAGG - Intergenic
1001896045 5:175382235-175382257 ATGGTTGCACAGCTCAGTGGAGG - Intergenic
1002993152 6:2256480-2256502 TAGGAGGCACAGCTCATTGGGGG + Intergenic
1004596311 6:17102880-17102902 GAGGCTGCACAGCTAATTTGGGG + Intronic
1006847050 6:37069632-37069654 GTGGTAGCACAGCACAGTGAAGG - Intergenic
1009974206 6:70655572-70655594 GTGGCAGAAGAGCTGAGTGGTGG + Intergenic
1014370039 6:120594617-120594639 GTGGCACCACATTTCATTGTGGG - Intergenic
1014790234 6:125664130-125664152 GTTACAACACAACTCATTGGAGG - Intergenic
1017639715 6:156480304-156480326 GTGGCAGCACAACTCTATGAGGG + Intergenic
1019696842 7:2450952-2450974 GTGGCAGCTCAGCCCCTTGTGGG + Intergenic
1022534537 7:31087641-31087663 ATGACAGCACAGCTCTGTGGTGG + Exonic
1024768714 7:52691975-52691997 GTGGCATCACCTCTCATTGTAGG - Intergenic
1025482127 7:60993926-60993948 GTGAGATCACAGCTCAGTGGAGG - Intergenic
1026890950 7:73982133-73982155 GTGACAGCAAAGCTCATCAGGGG + Intergenic
1033598138 7:142870877-142870899 GAGGCAGCAGGGCTCAGTGGAGG + Exonic
1035045638 7:155963689-155963711 AGGGCAGCACAGCTTATTAGAGG + Intronic
1035141612 7:156768486-156768508 GTGGCAGCCCATCACAATGGAGG - Intronic
1036261466 8:7244066-7244088 GTGGTAAGAAAGCTCATTGGTGG - Intergenic
1036305135 8:7595490-7595512 GTGGTAAGAAAGCTCATTGGTGG + Intergenic
1036313506 8:7702610-7702632 GTGGTAAGAAAGCTCATTGGTGG - Intergenic
1036355987 8:8043486-8043508 GTGGTAAGAAAGCTCATTGGTGG + Intergenic
1037522683 8:19695400-19695422 CTGGCCGCACAGCTAATTAGTGG - Intronic
1039812034 8:41057740-41057762 TTGGCATCACACCTCATTGCTGG - Intergenic
1047006830 8:120629104-120629126 GTGTCAGTACAGCTTGTTGGGGG - Intronic
1052591217 9:30497934-30497956 GTATCAGCACAGCTCAGGGGAGG + Intergenic
1053256706 9:36623400-36623422 CTGGCAGCAGAGCTCATTTTTGG + Intronic
1057638711 9:96796434-96796456 GGGGCTGCACAGCTCATCTGAGG - Intergenic
1060377948 9:123135117-123135139 GTGGTAACACAGCTAATTGATGG - Intronic
1061845793 9:133387318-133387340 GTGGGAGCACTGCCCACTGGAGG - Intronic
1061921306 9:133783940-133783962 GCGACATCACAGCTCACTGGAGG + Intronic
1192160387 X:68782038-68782060 GTGGCAGGACAGGTTATGGGAGG + Intergenic
1192161461 X:68791311-68791333 GTGGCAGGACAGGTTATGGGAGG - Intergenic
1192239331 X:69316922-69316944 GTGGCAGAACAGGTTATGGGAGG - Intergenic
1194344816 X:92750772-92750794 ATGGCAGTACAGCTCAGTGGGGG + Intergenic
1194751200 X:97685927-97685949 GTGGCAGCATACCTAATTTGAGG - Intergenic
1194976749 X:100403719-100403741 GTTGCAGCACAGCTGCTTGTAGG - Intronic
1195578565 X:106476831-106476853 GTGGCAGAACAGGTTATAGGAGG + Intergenic
1196584147 X:117409685-117409707 GGGGCAGCACAGCTCACAGTAGG - Intergenic
1196613258 X:117737866-117737888 ATGGCAGCACACCTGATTCGTGG - Intergenic
1197784525 X:130187010-130187032 GTGGGAGCCCAGCCCTTTGGGGG - Intergenic
1198713432 X:139530466-139530488 GTGGCAGCACAGTTCATCAGTGG - Intergenic
1199718633 X:150525708-150525730 GTGGCTGCAAAGCTCCTTTGGGG + Intergenic
1200653160 Y:5867413-5867435 ATGGCAGTACAGCTCAGTGGGGG + Intergenic
1201963258 Y:19705970-19705992 GTGGCACCAAAGGTCATTTGTGG - Exonic