ID: 914342788

View in Genome Browser
Species Human (GRCh38)
Location 1:146774497-146774519
Sequence GCGGTAAGCCGGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914342788_914342794 25 Left 914342788 1:146774497-146774519 CCTTCCTCACTCCGGCTTACCGC No data
Right 914342794 1:146774545-146774567 TCATAATGCTTTTCCAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914342788 Original CRISPR GCGGTAAGCCGGAGTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr