ID: 914346102

View in Genome Browser
Species Human (GRCh38)
Location 1:146799628-146799650
Sequence TTACCACAGCTGATGGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914346096_914346102 3 Left 914346096 1:146799602-146799624 CCACCACTGGTTCCTTCCTCTCC No data
Right 914346102 1:146799628-146799650 TTACCACAGCTGATGGTCTCTGG No data
914346098_914346102 -9 Left 914346098 1:146799614-146799636 CCTTCCTCTCCATATTACCACAG No data
Right 914346102 1:146799628-146799650 TTACCACAGCTGATGGTCTCTGG No data
914346095_914346102 4 Left 914346095 1:146799601-146799623 CCCACCACTGGTTCCTTCCTCTC No data
Right 914346102 1:146799628-146799650 TTACCACAGCTGATGGTCTCTGG No data
914346097_914346102 0 Left 914346097 1:146799605-146799627 CCACTGGTTCCTTCCTCTCCATA No data
Right 914346102 1:146799628-146799650 TTACCACAGCTGATGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914346102 Original CRISPR TTACCACAGCTGATGGTCTC TGG Intergenic
No off target data available for this crispr