ID: 914352142

View in Genome Browser
Species Human (GRCh38)
Location 1:146849695-146849717
Sequence CTGGGTTACCACTTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914352142_914352149 3 Left 914352142 1:146849695-146849717 CCATGCACCAAGTGGTAACCCAG No data
Right 914352149 1:146849721-146849743 ATATCCACACTGGTGGGTATAGG No data
914352142_914352148 -3 Left 914352142 1:146849695-146849717 CCATGCACCAAGTGGTAACCCAG No data
Right 914352148 1:146849715-146849737 CAGACAATATCCACACTGGTGGG No data
914352142_914352144 -7 Left 914352142 1:146849695-146849717 CCATGCACCAAGTGGTAACCCAG No data
Right 914352144 1:146849711-146849733 AACCCAGACAATATCCACACTGG No data
914352142_914352147 -4 Left 914352142 1:146849695-146849717 CCATGCACCAAGTGGTAACCCAG No data
Right 914352147 1:146849714-146849736 CCAGACAATATCCACACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914352142 Original CRISPR CTGGGTTACCACTTGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr