ID: 914363490

View in Genome Browser
Species Human (GRCh38)
Location 1:146957264-146957286
Sequence CTGGGAACGCTGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 7, 1: 4, 2: 1, 3: 39, 4: 295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914363490 Original CRISPR CTGGGAACGCTGAAGGTGGG AGG Intronic
900394206 1:2446477-2446499 CTGGGACCCCTGCAGCTGGGGGG - Intronic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
900561500 1:3309277-3309299 CTGGGAACACTAATGGTGGAGGG + Intronic
900722777 1:4188404-4188426 CTGAGAACTCCAAAGGTGGGGGG - Intergenic
900928576 1:5721311-5721333 CTAGGAACCCCAAAGGTGGGAGG + Intergenic
901130989 1:6962555-6962577 GTGGGAAGGCTGGATGTGGGCGG - Intronic
901658114 1:10782219-10782241 CTGGGAATGCTTAAGTGGGGAGG + Intronic
901809379 1:11758526-11758548 ATGGGAAGGCTGAAGGTAGAAGG + Intergenic
902231105 1:15028200-15028222 GTGGGGACTCTGGAGGTGGGAGG - Intronic
903071150 1:20727515-20727537 CTGTGGGCGCTGAAGGTGGGTGG - Exonic
903157739 1:21459668-21459690 CTGGGAACGCTGAAGATGGGAGG + Intronic
904193392 1:28765107-28765129 CTGGGGAGGCTGAAGGCAGGAGG - Intronic
904699696 1:32351215-32351237 CAGGGGGCGCTGTAGGTGGGCGG - Intergenic
904963635 1:34354775-34354797 CAGGGAGCGCTGGAGCTGGGTGG - Intergenic
906116709 1:43361818-43361840 CAGTGAAGGCTGAATGTGGGGGG - Intronic
906213338 1:44024438-44024460 CTGGGCAGGCTGGTGGTGGGTGG - Intronic
906640162 1:47436956-47436978 CTGGGAGCCAGGAAGGTGGGGGG + Exonic
906690166 1:47787297-47787319 GTGGAAACGCTGAATGTTGGGGG + Intronic
906753312 1:48285733-48285755 GAGGGAAAGCTGAAGCTGGGTGG - Intergenic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
908896688 1:68909188-68909210 CTCAGGAGGCTGAAGGTGGGTGG + Intergenic
908981355 1:69963060-69963082 TTCGGGAGGCTGAAGGTGGGCGG + Intronic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
910741672 1:90525863-90525885 CTGGGAATGGTGTAGGTGTGGGG + Intergenic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
912414066 1:109496264-109496286 CTGCGAACGCTGAATCTAGGTGG + Exonic
912936263 1:114005937-114005959 CTGGGATTGCTGAATGTGGGGGG + Intergenic
913344266 1:117792597-117792619 CTGGGAGCCCTGGAGATGGGAGG + Intergenic
913544483 1:119853720-119853742 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
913602316 1:120433658-120433680 CTGGGAACGCTGAAGGTGGGAGG + Intergenic
913991862 1:143620499-143620521 TTGGGAACGCTGAAGGTGGGAGG - Intergenic
914084730 1:144442979-144443001 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914190742 1:145408145-145408167 CTGGGAACGCTGAAGGTGGGAGG - Intergenic
914363490 1:146957264-146957286 CTGGGAACGCTGAAGGTGGGAGG + Intronic
914488187 1:148129870-148129892 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914588551 1:149084990-149085012 CTGGGAACGCTGAAGGTGGGAGG - Intronic
914958316 1:152184510-152184532 ATGGGAACGATGGAGATGGGAGG + Intergenic
915523282 1:156460950-156460972 TTGGAAACGGGGAAGGTGGGGGG + Intergenic
915748168 1:158181148-158181170 GGGGAAGCGCTGAAGGTGGGTGG + Exonic
916358765 1:163943585-163943607 CTGAGGAGGCTGAAGCTGGGAGG + Intergenic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
917624168 1:176829366-176829388 CTGGGAATGCAGACTGTGGGAGG - Intronic
918186712 1:182134169-182134191 CAGGGAAGGCTTCAGGTGGGAGG - Intergenic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921374597 1:214460795-214460817 CTGGGAAAGCTGAATGTGCTAGG - Intronic
923267382 1:232327828-232327850 CTGGGCACGCTGAATGGGGTCGG - Intergenic
924683906 1:246267961-246267983 CTGGGAATGGTGAATGTGTGAGG - Intronic
1063050744 10:2444430-2444452 CTTGGGAGGCTGGAGGTGGGAGG + Intergenic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1064645384 10:17454365-17454387 CTGTGAACGCTGTGGGTGCGCGG - Intergenic
1067110903 10:43399186-43399208 TTGGGGAGGCTAAAGGTGGGAGG - Intronic
1067141610 10:43662248-43662270 CTGGGATGGAAGAAGGTGGGAGG + Intergenic
1068942080 10:62690219-62690241 CGGGGAAGGCTGGATGTGGGTGG - Intergenic
1069045951 10:63743121-63743143 CTGGGAAGAATGAAGGTAGGTGG + Intergenic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071811801 10:89190139-89190161 TTGGGGACTCTGGAGGTGGGGGG - Intergenic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074904196 10:117846756-117846778 CTGGGAACACTTAAGCAGGGAGG - Intergenic
1075310905 10:121412691-121412713 CTGGGAACGGTGGGGGTGAGTGG - Intergenic
1075814831 10:125256917-125256939 CTCGGGAGGCTAAAGGTGGGAGG - Intergenic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076428188 10:130382123-130382145 CTGTGAACTCTGAGGGTTGGGGG + Intergenic
1076635658 10:131880485-131880507 CAGGCAACGTTGAGGGTGGGGGG - Intergenic
1076739815 10:132477634-132477656 CTGGGGCCCCTGGAGGTGGGCGG - Intergenic
1076783125 10:132735427-132735449 CTGGGAATGCTGGAGGCTGGGGG + Intronic
1077276205 11:1710266-1710288 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1077613030 11:3656290-3656312 CTCGGCAGGCTGAAGGTAGGAGG - Intronic
1077707362 11:4499840-4499862 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1078584685 11:12572846-12572868 CTTGGAATGGTGATGGTGGGAGG + Intergenic
1079354428 11:19718047-19718069 CTGGGAAGGGTGGGGGTGGGTGG - Intronic
1080651980 11:34230090-34230112 CTGGGAAGCCTGTAGGTGGGAGG + Intronic
1080944516 11:36956533-36956555 CATGGGATGCTGAAGGTGGGAGG + Intergenic
1081907987 11:46681233-46681255 CCTGGAACTCTGAAGCTGGGAGG - Intronic
1082820109 11:57538855-57538877 CTGTGAATGCTGGGGGTGGGTGG + Intergenic
1083420025 11:62547157-62547179 CTGGGGGCTCTGAAGGTGGCTGG + Intronic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1084344822 11:68539812-68539834 CAGGGACTGCTGAAGGTGGTGGG + Intronic
1084601353 11:70147616-70147638 TTGGGAAATCAGAAGGTGGGAGG + Intronic
1085126807 11:74007537-74007559 CTCGGGAGGCTGAAGGTGGGAGG - Intronic
1085250697 11:75141744-75141766 CTTGGAAAGCTTGAGGTGGGAGG + Intronic
1085251207 11:75145085-75145107 CTGGGGAGGCTGAAGTGGGGAGG - Intronic
1085251281 11:75145446-75145468 ATGGGGACTCTGCAGGTGGGCGG - Intronic
1087567031 11:99874048-99874070 CTGGGAACTCTGAAAGAGGGAGG + Intronic
1088603524 11:111506467-111506489 CTGGGGACTCCAAAGGTGGGTGG + Intronic
1089189483 11:116643765-116643787 CTGGCCACACAGAAGGTGGGTGG + Intergenic
1089500893 11:118930568-118930590 CTGGGAAGGCTGATGGAAGGAGG + Intronic
1091449676 12:564733-564755 CTGGGCATGCTGAAGGTTGAGGG - Intronic
1091628444 12:2140215-2140237 CTGGGAACAGTCACGGTGGGTGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091831669 12:3554624-3554646 GTGGGAAGGCTGGAGCTGGGAGG + Intronic
1091942781 12:4504079-4504101 ATGGGATAACTGAAGGTGGGAGG + Intronic
1092696058 12:11172380-11172402 GTGGGAATGTTGAAGGAGGGCGG + Intergenic
1092803618 12:12197934-12197956 CTTGGGAGGCTCAAGGTGGGAGG + Intronic
1096174330 12:49502557-49502579 CTAGGGAGGCTGAGGGTGGGAGG - Intronic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1097185095 12:57192493-57192515 CTGGGAAAGCTGCAGGTCTGTGG - Intronic
1097233342 12:57525161-57525183 CTTGGAAGGCTGGTGGTGGGAGG + Intronic
1097288024 12:57892580-57892602 CTTGGCACCCAGAAGGTGGGGGG + Intergenic
1099537021 12:83857624-83857646 CTGGGAACAGGGAAGTTGGGTGG + Intergenic
1099619604 12:84984469-84984491 CTCAGGAAGCTGAAGGTGGGAGG - Intergenic
1099890445 12:88583202-88583224 CAGGGAATGGTGGAGGTGGGAGG - Intergenic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1100504533 12:95206580-95206602 CTTGGGAGGCTGAAGGTGGGTGG + Intronic
1101218965 12:102616796-102616818 CTGGGAAGAATGAAGGTAGGAGG - Intergenic
1101351142 12:103930626-103930648 CTGGGGGCGTTGAACGTGGGAGG + Intronic
1103017286 12:117505273-117505295 TTGAGCACACTGAAGGTGGGTGG + Intronic
1103343223 12:120232378-120232400 CTGGGACCTCTGGAGGAGGGAGG - Intronic
1104648476 12:130514004-130514026 CTGGGGAGGCTGAAGGTGTGGGG - Intronic
1104748437 12:131223953-131223975 CTGGGCAGGCTGGATGTGGGCGG + Intergenic
1106295454 13:28409440-28409462 CTCGGAAGGCTGAAGTTGGAGGG - Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1112508121 13:99987724-99987746 CTGGGAGAGCTGGAGGGGGGAGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113406378 13:110044659-110044681 CTGGGAGAGGTGGAGGTGGGGGG - Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113937248 13:114001001-114001023 CTCAGAACGCAGAAAGTGGGGGG - Intronic
1115213641 14:30992931-30992953 CTCAGAAGGCTGAAGTTGGGAGG - Intronic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115584626 14:34798187-34798209 CTGGGAAAGCTCAAACTGGGCGG + Intronic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1119354381 14:73993227-73993249 CTTGGGAAGCTGGAGGTGGGAGG + Intronic
1120829418 14:88984843-88984865 CTGGGAAGGCTGATGGAAGGAGG + Intergenic
1121304716 14:92898888-92898910 CTGGGAAGGCTGGAGGTGGGTGG - Intergenic
1121406667 14:93723205-93723227 CTGGGAACCCTGGAGGGGGCTGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122587321 14:102817983-102818005 CTGGGAAGGCTGGAGAGGGGTGG + Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1127446973 15:59073062-59073084 CTTGGGAGGCTGAAGTTGGGAGG + Intronic
1128357190 15:66936440-66936462 CTGGGGACGCCGTGGGTGGGTGG - Intergenic
1128423755 15:67519744-67519766 CTTGGGAGGCTGAGGGTGGGAGG + Intergenic
1129084011 15:73069059-73069081 CTTGGGAGGCTGAAGGGGGGAGG - Intronic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1131412455 15:92221181-92221203 TTGGCAACACTGAAGGTGGTGGG - Intergenic
1132971276 16:2690370-2690392 CTGGGACCTCTGGAGATGGGTGG + Intronic
1133681181 16:8121645-8121667 CTGGGAACCCAGGAGGTGGAGGG - Intergenic
1134560111 16:15201657-15201679 CTGGGAAGCCTGATGGTTGGAGG + Intergenic
1134808188 16:17143613-17143635 CAGGGAACACTGAAGGGGAGAGG - Intronic
1134920650 16:18113267-18113289 CTGGGAAGCCTGATGGTTGGAGG + Intergenic
1135267302 16:21038407-21038429 CTCGGAAGGCTAAGGGTGGGAGG + Intronic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1136863293 16:33715984-33716006 TTGGGAATGCTGCAGCTGGGAGG - Intergenic
1137565866 16:49532224-49532246 CTGGAGACTCTGACGGTGGGTGG + Intronic
1138211189 16:55164554-55164576 CTGGGAACGATGGAGATGAGTGG + Intergenic
1140899988 16:79358478-79358500 CTGGGATCTCTGGAGTTGGGTGG - Intergenic
1141896779 16:86963404-86963426 ATGCGGACGCTGGAGGTGGGAGG + Intergenic
1142526907 17:549370-549392 TTGGGAACGCAGCAGCTGGGAGG - Intronic
1142610781 17:1108460-1108482 CTGGGTCAGCTGAAGGGGGGAGG - Intronic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1145743954 17:27299266-27299288 TTTGGGAGGCTGAAGGTGGGAGG + Intronic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1146156806 17:30531110-30531132 GTGGGAGAGCTGAAGCTGGGAGG - Intergenic
1146948240 17:36888686-36888708 CTGGGGCAGCTGAAGCTGGGAGG - Intergenic
1147583240 17:41638491-41638513 CTGGGAAGGTGGAGGGTGGGAGG - Intergenic
1148210488 17:45805686-45805708 CTGGGAACTCTGCTGGTGGCCGG + Intronic
1148598723 17:48878004-48878026 CTCAGGAGGCTGAAGGTGGGAGG - Intergenic
1149467739 17:56893096-56893118 CTGGGATCGGGGAAGCTGGGTGG + Intronic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1150616880 17:66779088-66779110 CTGGGATTGCTGAAGCTTGGAGG - Intronic
1150682147 17:67292844-67292866 CTGGGAAGGCTGAGGCTGAGGGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1151356797 17:73563468-73563490 CTCAGAAGGCTGAATGTGGGAGG + Intronic
1152615476 17:81335981-81336003 CTGGGCATGCTCAAGGAGGGCGG - Intergenic
1152636241 17:81431586-81431608 CTGGGAACCCTGAAGCTGCAGGG - Intronic
1152915182 17:83030894-83030916 CTGGGAACCCTGAAGGGCGAAGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1155491252 18:26404133-26404155 CTTGGAAGGCTGAAGTTGGGGGG - Intergenic
1155628737 18:27865960-27865982 CTATGAATGCTGAAGATGGGTGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1159948167 18:74458695-74458717 CTGGGATGGATGGAGGTGGGGGG - Intergenic
1160328089 18:77968753-77968775 CTGGGAAGGTTGAAGGGGGCTGG - Intergenic
1160717665 19:583687-583709 CTGGGAACTTGGAAGGTGGCTGG + Intergenic
1161417135 19:4153667-4153689 CAGGTAACGCTGGCGGTGGGTGG + Exonic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1162749693 19:12821307-12821329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1162778371 19:12993911-12993933 CTGGTAACCCTCAGGGTGGGTGG - Intergenic
1162799910 19:13104630-13104652 TGGAGAGCGCTGAAGGTGGGAGG + Intergenic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163226015 19:15961931-15961953 TTGGGGATGCTGAAGCTGGGTGG - Intergenic
1163393681 19:17046169-17046191 CTGGGACCCCAGCAGGTGGGGGG - Intergenic
1163844074 19:19628655-19628677 CTGGCAAAGCCGAAGCTGGGCGG - Exonic
1164441476 19:28283340-28283362 GTGGGAAAGATGATGGTGGGGGG - Intergenic
1165118605 19:33544835-33544857 CTGGCTGCGCTGGAGGTGGGTGG - Intergenic
1165263800 19:34643411-34643433 CTGGGAAGGGTGTGGGTGGGGGG + Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1167609586 19:50500798-50500820 CTGGGGGCGCTGGGGGTGGGGGG - Intergenic
1168028764 19:53663312-53663334 CTGGGGACGCCGTGGGTGGGAGG + Intergenic
1168105509 19:54163680-54163702 CTGGGAATGATGAAGGGTGGGGG - Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
926150383 2:10422667-10422689 CTGGGAATGCTGAGGGAGAGTGG - Intronic
926276903 2:11410832-11410854 CTGGGATAACTGGAGGTGGGAGG - Intergenic
927069030 2:19506160-19506182 CTGGGAAAGCTGAACGTGTATGG + Intergenic
927501843 2:23588390-23588412 CCTGGGAGGCTGAAGGTGGGTGG - Intronic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
932451351 2:71812727-71812749 CTGGAAGAGCTGTAGGTGGGAGG + Intergenic
932480026 2:72033484-72033506 CAGGGAATGCTGATGGTGGGCGG - Intergenic
932542038 2:72665016-72665038 CTGAGAACACTGAAGAGGGGTGG + Intronic
934160974 2:89249245-89249267 CTGGGAAAGCTGAATGGTGGGGG + Intergenic
934206303 2:89933188-89933210 CTGGGAAAGCTGAATGGTGGGGG - Intergenic
935329381 2:101965360-101965382 CTGGAAACTCTGGAGGTGGGTGG + Intergenic
935949777 2:108318098-108318120 CTTGGGAGGCTGGAGGTGGGAGG - Intergenic
936345861 2:111674404-111674426 TTTGGAAGGCTGAGGGTGGGTGG + Intergenic
936561269 2:113541721-113541743 CTGGCAGCGGAGAAGGTGGGCGG + Intergenic
940620880 2:156111846-156111868 CAGGGAAGGCTGTAGGTAGGAGG - Intergenic
942455621 2:176136574-176136596 CTGGGAAAGCAGAATGCGGGGGG - Intergenic
943101067 2:183487150-183487172 CTGGGAAGGCTAAAGTTGAGGGG + Intergenic
946587031 2:221201229-221201251 TTGAGAATGCTGAAGGTGAGTGG + Intergenic
1168925262 20:1574127-1574149 CTGGGAGTGCTGAGGGAGGGAGG + Intronic
1168929140 20:1607155-1607177 CTGGGAGTGCTGAGGGAGGGAGG + Intronic
1169116710 20:3071254-3071276 CTGGGACCCCTCCAGGTGGGAGG - Intergenic
1171123526 20:22584235-22584257 CTGGGAGCGGTGAAGATGGAAGG - Exonic
1173143663 20:40506558-40506580 CTGGGCACCCTGAAGGTTGAAGG - Intergenic
1174234898 20:49081390-49081412 CTCGGGAGGCTGAAAGTGGGAGG - Intronic
1175177289 20:57119894-57119916 CTGGCACTGCTGGAGGTGGGTGG + Intergenic
1176006706 20:62868418-62868440 CTTGGGAGGCTGGAGGTGGGAGG + Intergenic
1177071469 21:16514040-16514062 CTTGGGACTCTAAAGGTGGGAGG - Intergenic
1178249590 21:30989501-30989523 TTGGGAAAGCTCAAGATGGGTGG - Intergenic
1180636957 22:17269240-17269262 CTAGGAAAGGTGAAGGTGGGGGG + Intergenic
1180833090 22:18915963-18915985 CTGGGAAGGCGGAATCTGGGAGG + Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181066735 22:20310291-20310313 CTGGGAAGGCGGAATCTGGGAGG - Intergenic
1181932742 22:26415763-26415785 CTAGAAATGCAGAAGGTGGGTGG - Intergenic
1182387987 22:29963026-29963048 CTCGGGAGGCTGAAAGTGGGAGG - Intronic
1183381125 22:37491068-37491090 CTAGGAAGGCTCAGGGTGGGAGG + Exonic
1183730756 22:39617288-39617310 CTGGGAAGGCAGCACGTGGGTGG + Intronic
1183888943 22:40909308-40909330 TTGTGAAAGCTGAAGGTGAGAGG - Intronic
1183985714 22:41569069-41569091 CTGGGAAAACTGCAGTTGGGAGG + Intronic
1184666691 22:45992985-45993007 ATGGGAAGGCAGAAGGTGTGTGG - Intergenic
1203283174 22_KI270734v1_random:141267-141289 CTGGGAAGGCGGAATCTGGGAGG + Intergenic
949500096 3:4671590-4671612 CTGGGGACCGTGGAGGTGGGTGG - Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950404704 3:12797182-12797204 GTGGGCTCGCTGAAGGTGGTGGG - Intronic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
952123531 3:30273390-30273412 CTGGGAGGGTTGAGGGTGGGGGG - Intergenic
954802728 3:53196462-53196484 CTCGGGAGGCTGAGGGTGGGAGG - Intergenic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
961848884 3:129794817-129794839 CTGGGACGGCTGAAGAGGGGAGG - Intronic
962035608 3:131648262-131648284 CTTGGGAGGCTGAAGGTGGGAGG + Intronic
964718529 3:159748554-159748576 CTGGGCACAGTGAAGGAGGGTGG - Intronic
965757353 3:172040106-172040128 CTGGGAAGGCTGGGGGTGGGGGG - Intronic
966407418 3:179612238-179612260 CTCCGCAAGCTGAAGGTGGGAGG + Intronic
967304155 3:188044502-188044524 AGGTGAAAGCTGAAGGTGGGGGG + Intergenic
967814410 3:193787144-193787166 CGGAGAGCGCTGGAGGTGGGTGG + Intergenic
968032382 3:195511415-195511437 CTGGGGAGGCTTGAGGTGGGAGG + Intergenic
968839507 4:2992119-2992141 CTTGGGACGCTGAGGTTGGGAGG - Intronic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
976178755 4:82379879-82379901 CTTGGGAGGCTGAGGGTGGGAGG - Intergenic
978417375 4:108490773-108490795 CTGGGGAGGGTGGAGGTGGGTGG + Intergenic
979523182 4:121691542-121691564 CGTGGAATGCTGGAGGTGGGGGG - Intronic
981180515 4:141737230-141737252 CTGGGATTGGTGAGGGTGGGTGG - Intergenic
985068742 4:186147273-186147295 CTAGAGAGGCTGAAGGTGGGAGG + Intronic
985612194 5:896203-896225 CTCAGAAGGCTGGAGGTGGGAGG + Intronic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
988962144 5:36380885-36380907 CTGGGAAGGATGGAGGTAGGAGG + Intergenic
990429425 5:55719608-55719630 CTGGGGAAGCTGAAGTGGGGGGG - Intronic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992079886 5:73226190-73226212 CTGGGGACTCTAAAGGTGTGGGG - Intergenic
992444554 5:76821821-76821843 TTTGGGAGGCTGAAGGTGGGTGG - Intronic
994570617 5:101508554-101508576 TTGAGTAGGCTGAAGGTGGGGGG - Intergenic
996281010 5:121729010-121729032 CTGAGAATGCTTAAGGTGGTTGG - Intergenic
999161990 5:149509166-149509188 CTTGGTAGGCTGAAGGAGGGTGG - Intronic
999204645 5:149839425-149839447 CAAGGAAGGCTGCAGGTGGGTGG + Intronic
1001485165 5:172114862-172114884 CAGTGAAGGCCGAAGGTGGGGGG - Intronic
1001964694 5:175901969-175901991 CTGGGAGCTCCGAAGGTGGTAGG - Intergenic
1002041020 5:176514294-176514316 TTGGGAGCCCTGAATGTGGGTGG + Intergenic
1002331375 5:178443133-178443155 AGGGAAACGCTGTAGGTGGGTGG - Intronic
1003536999 6:6983948-6983970 CTCGGGAGGCTGAGGGTGGGAGG + Intergenic
1003593436 6:7454854-7454876 CTGACAGTGCTGAAGGTGGGGGG - Intergenic
1005705773 6:28451256-28451278 CTGGGAAGGATGTAGGTGTGGGG - Intergenic
1006925250 6:37650381-37650403 TTGGGCACACTGATGGTGGGCGG + Exonic
1007661629 6:43490269-43490291 CGGGGAAGGGTGACGGTGGGGGG - Intronic
1007671688 6:43559922-43559944 CTGGGGAGGCTTAAGGTGGGAGG - Intronic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1009898578 6:69783480-69783502 CTTGGAAGCCTGAAGGTGGGAGG - Intronic
1013953833 6:115817859-115817881 TTTGGAAGGCTGAAGGGGGGTGG + Intergenic
1014093055 6:117427179-117427201 CTGGGAAGGGTGGTGGTGGGTGG - Intronic
1015928682 6:138335028-138335050 CTGGGGACGCTGAAGCAGCGGGG - Exonic
1017441697 6:154470307-154470329 CTTGGGAGGCTGAAGGTGGGAGG - Intronic
1018606790 6:165606029-165606051 CTGGGCACGCAGCAGGTGCGTGG + Intronic
1019575914 7:1737584-1737606 CAGGGAACGTTGAAGGTGGAGGG - Intronic
1019785151 7:2972103-2972125 CTGGGGAGGCTTGAGGTGGGAGG - Intronic
1019958648 7:4437555-4437577 CTGGGAACAGTAAAGGTGTGGGG - Intergenic
1020226705 7:6285987-6286009 CTCGGGAGGCTGGAGGTGGGAGG - Intergenic
1023993707 7:45146049-45146071 CAGGGAATGCTGATGGCGGGGGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1026355416 7:69553097-69553119 CTGGGGAGGCTGGAGGTAGGAGG - Intergenic
1026742941 7:72990331-72990353 CTGGGAGCCCAGAAGGTGGGGGG + Intergenic
1027100794 7:75374747-75374769 CTGGGAGCCCAGAAGGTGGGGGG - Intergenic
1027387074 7:77669236-77669258 CTTGGGAAGCTGAAGTTGGGGGG + Intergenic
1028616063 7:92768142-92768164 CAAGGGATGCTGAAGGTGGGAGG + Intronic
1030400175 7:109039701-109039723 CAGGGAATTCTAAAGGTGGGAGG - Intergenic
1031374241 7:121004603-121004625 CTGGGCAGGATGGAGGTGGGAGG + Intronic
1034706736 7:153152451-153152473 CTGGGAGCCCTGAAGCTGGGTGG + Intergenic
1034940293 7:155226358-155226380 CTGAGAAAGCTGCAGATGGGAGG + Intergenic
1037190556 8:16119467-16119489 TTTGGGATGCTGAAGGTGGGTGG - Intronic
1037442323 8:18928923-18928945 CTTGGGAGGCTGGAGGTGGGAGG - Intronic
1042935511 8:74054268-74054290 TTTGGAAGGCTTAAGGTGGGAGG - Intergenic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1044242996 8:89908408-89908430 CTGGGAACTCTGAAGGTTATAGG + Intronic
1045045337 8:98269839-98269861 CTGGGAACTCTGGAGGAGGGAGG - Intronic
1045075714 8:98564958-98564980 CAGGGAAGACTGAATGTGGGTGG + Intronic
1046985683 8:120385794-120385816 CTCAGAAGGGTGAAGGTGGGAGG - Intronic
1047511719 8:125520797-125520819 CTTTGAATGCTAAAGGTGGGTGG + Intergenic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049158902 8:141084783-141084805 CAGGCCACGCTGAAGGTGGGCGG + Intergenic
1049473807 8:142787788-142787810 CTGGCTAGGCTGAAGGTGAGTGG + Intergenic
1049545951 8:143230775-143230797 GTCGGAACGCTGAGGGTGCGTGG - Intergenic
1049706815 8:144046950-144046972 CTGGTGACGCTGGAGCTGGGAGG + Exonic
1049891423 9:73618-73640 CTGGCAGCGGAGAAGGTGGGCGG - Intergenic
1051782807 9:20708665-20708687 CTTGGAAGGCTGAGGATGGGCGG + Intronic
1052812148 9:33070866-33070888 CTGGGAAGGGTGGAGGTGGCGGG + Intronic
1053732845 9:41074692-41074714 CTGGCAGCGGAGAAGGTGGGCGG - Intergenic
1054695584 9:68356862-68356884 CTGGCAGCGGAGAAGGTGGGTGG + Intronic
1055693162 9:78856024-78856046 ATGGGACAGCTGCAGGTGGGTGG + Intergenic
1057141438 9:92728905-92728927 CTGGGGACGCTGCAGCTGGCTGG - Intronic
1058655556 9:107217363-107217385 CTGGGAGAGATGAAGATGGGAGG + Intergenic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1061421691 9:130476221-130476243 CTGGGGCCTCCGAAGGTGGGAGG + Intronic
1061836737 9:133334384-133334406 CAGGGAACCCTGCAGGTGAGAGG - Exonic
1061901703 9:133675983-133676005 CTTGGAAGGCTGAAGGGGGGAGG + Intronic
1061908682 9:133711711-133711733 CTGGGGAGGCAGTAGGTGGGTGG - Intronic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1062595970 9:137299421-137299443 CTGGGCACGCTGGAGGTGCTGGG + Intergenic
1062716779 9:138014623-138014645 CTGTGAGCTCTGCAGGTGGGTGG + Intronic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1186881602 X:13872276-13872298 CGTGGAAGGCTGAAGGTGGGAGG - Intronic
1186976979 X:14917914-14917936 CTGAGAAGGCTGAAAGTGCGGGG + Intronic
1188628769 X:32323984-32324006 CTGGGAAGAGTGTAGGTGGGCGG + Intronic
1192189130 X:68980041-68980063 CAGGGACCTCTGAAGGTGGGTGG + Intergenic
1192806273 X:74512225-74512247 CTGGGAACTCTGAAGAGGTGTGG + Intronic
1193456816 X:81741779-81741801 CTGGGGACCCTGAAGTAGGGAGG - Intergenic
1199427514 X:147719972-147719994 CTGGGAATGTTGATGGTAGGTGG - Intergenic
1200234672 X:154462491-154462513 CTGGCAATGGTGAGGGTGGGCGG - Intronic
1201379872 Y:13363291-13363313 CTGGGAAGGCTGAGGTTGTGAGG - Intronic
1201579112 Y:15492569-15492591 CTCAGGAGGCTGAAGGTGGGAGG + Intergenic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1202382956 Y:24294568-24294590 CTGGGAACGGTGGAGGGGTGGGG - Intergenic
1202487828 Y:25375553-25375575 CTGGGAACGGTGGAGGGGTGGGG + Intergenic