ID: 914365572

View in Genome Browser
Species Human (GRCh38)
Location 1:146975159-146975181
Sequence CTCACTAAGGGTAAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914365572_914365577 0 Left 914365572 1:146975159-146975181 CCATCCCACTTACCCTTAGTGAG No data
Right 914365577 1:146975182-146975204 AATCACCTCCTGACTGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914365572 Original CRISPR CTCACTAAGGGTAAGTGGGA TGG (reversed) Intronic
No off target data available for this crispr