ID: 914365577

View in Genome Browser
Species Human (GRCh38)
Location 1:146975182-146975204
Sequence AATCACCTCCTGACTGACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914365572_914365577 0 Left 914365572 1:146975159-146975181 CCATCCCACTTACCCTTAGTGAG No data
Right 914365577 1:146975182-146975204 AATCACCTCCTGACTGACTGCGG No data
914365574_914365577 -5 Left 914365574 1:146975164-146975186 CCACTTACCCTTAGTGAGAATCA 0: 21
1: 5
2: 1
3: 9
4: 110
Right 914365577 1:146975182-146975204 AATCACCTCCTGACTGACTGCGG No data
914365571_914365577 6 Left 914365571 1:146975153-146975175 CCATCACCATCCCACTTACCCTT 0: 1
1: 13
2: 8
3: 40
4: 438
Right 914365577 1:146975182-146975204 AATCACCTCCTGACTGACTGCGG No data
914365573_914365577 -4 Left 914365573 1:146975163-146975185 CCCACTTACCCTTAGTGAGAATC 0: 21
1: 6
2: 1
3: 6
4: 53
Right 914365577 1:146975182-146975204 AATCACCTCCTGACTGACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914365577 Original CRISPR AATCACCTCCTGACTGACTG CGG Intronic
No off target data available for this crispr