ID: 914370186

View in Genome Browser
Species Human (GRCh38)
Location 1:147017813-147017835
Sequence AGAGAGAATCTAATGGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914370186_914370197 15 Left 914370186 1:147017813-147017835 CCCCAAGCCATTAGATTCTCTCT No data
Right 914370197 1:147017851-147017873 GGTTGGGGGAGAGGTGTCATAGG No data
914370186_914370191 -2 Left 914370186 1:147017813-147017835 CCCCAAGCCATTAGATTCTCTCT No data
Right 914370191 1:147017834-147017856 CTCAGAGAATTTCCTGTGGTTGG No data
914370186_914370194 1 Left 914370186 1:147017813-147017835 CCCCAAGCCATTAGATTCTCTCT No data
Right 914370194 1:147017837-147017859 AGAGAATTTCCTGTGGTTGGGGG No data
914370186_914370192 -1 Left 914370186 1:147017813-147017835 CCCCAAGCCATTAGATTCTCTCT No data
Right 914370192 1:147017835-147017857 TCAGAGAATTTCCTGTGGTTGGG No data
914370186_914370193 0 Left 914370186 1:147017813-147017835 CCCCAAGCCATTAGATTCTCTCT No data
Right 914370193 1:147017836-147017858 CAGAGAATTTCCTGTGGTTGGGG No data
914370186_914370190 -6 Left 914370186 1:147017813-147017835 CCCCAAGCCATTAGATTCTCTCT No data
Right 914370190 1:147017830-147017852 CTCTCTCAGAGAATTTCCTGTGG No data
914370186_914370195 6 Left 914370186 1:147017813-147017835 CCCCAAGCCATTAGATTCTCTCT No data
Right 914370195 1:147017842-147017864 ATTTCCTGTGGTTGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914370186 Original CRISPR AGAGAGAATCTAATGGCTTG GGG (reversed) Intergenic
No off target data available for this crispr