ID: 914373548

View in Genome Browser
Species Human (GRCh38)
Location 1:147051870-147051892
Sequence TTGGCTGTTAATACGCACTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914373547_914373548 -6 Left 914373547 1:147051853-147051875 CCTTTGAAAATGATATGTTGGCT 0: 1
1: 2
2: 2
3: 31
4: 244
Right 914373548 1:147051870-147051892 TTGGCTGTTAATACGCACTCCGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914373548 Original CRISPR TTGGCTGTTAATACGCACTC CGG Intergenic