ID: 914373548 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:147051870-147051892 |
| Sequence | TTGGCTGTTAATACGCACTC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 34 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 31} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914373547_914373548 | -6 | Left | 914373547 | 1:147051853-147051875 | CCTTTGAAAATGATATGTTGGCT | 0: 1 1: 2 2: 2 3: 31 4: 244 |
||
| Right | 914373548 | 1:147051870-147051892 | TTGGCTGTTAATACGCACTCCGG | 0: 1 1: 0 2: 0 3: 2 4: 31 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914373548 | Original CRISPR | TTGGCTGTTAATACGCACTC CGG | Intergenic | ||