ID: 914374363

View in Genome Browser
Species Human (GRCh38)
Location 1:147060774-147060796
Sequence ATGAAGAAAAGCTCTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914374363_914374367 13 Left 914374363 1:147060774-147060796 CCCATATCAGAGCTTTTCTTCAT No data
Right 914374367 1:147060810-147060832 CTGCAACCAATTCAAATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914374363 Original CRISPR ATGAAGAAAAGCTCTGATAT GGG (reversed) Intergenic
No off target data available for this crispr