ID: 914375961

View in Genome Browser
Species Human (GRCh38)
Location 1:147073824-147073846
Sequence CTGCTGTTGTCAGACATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914375959_914375961 1 Left 914375959 1:147073800-147073822 CCACTTTGAGAACTCTGCCTTAC No data
Right 914375961 1:147073824-147073846 CTGCTGTTGTCAGACATGCCTGG No data
914375955_914375961 29 Left 914375955 1:147073772-147073794 CCTCAACAATTTTCTATGGAAGG No data
Right 914375961 1:147073824-147073846 CTGCTGTTGTCAGACATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914375961 Original CRISPR CTGCTGTTGTCAGACATGCC TGG Intergenic
No off target data available for this crispr