ID: 914376560

View in Genome Browser
Species Human (GRCh38)
Location 1:147078131-147078153
Sequence CTCTTTCCACGAAGGCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914376560_914376564 -1 Left 914376560 1:147078131-147078153 CCCCGGAGCCTTCGTGGAAAGAG No data
Right 914376564 1:147078153-147078175 GTTTCCCATCCAGCCCGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914376560 Original CRISPR CTCTTTCCACGAAGGCTCCG GGG (reversed) Intergenic
No off target data available for this crispr