ID: 914378794

View in Genome Browser
Species Human (GRCh38)
Location 1:147097889-147097911
Sequence TGTCCTATCATTGGAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914378794_914378799 8 Left 914378794 1:147097889-147097911 CCTGTCCCTCCAATGATAGGACA No data
Right 914378799 1:147097920-147097942 TCCAGTCTCATGCCTGCCAATGG No data
914378794_914378803 19 Left 914378794 1:147097889-147097911 CCTGTCCCTCCAATGATAGGACA No data
Right 914378803 1:147097931-147097953 GCCTGCCAATGGGCGGACAATGG No data
914378794_914378801 9 Left 914378794 1:147097889-147097911 CCTGTCCCTCCAATGATAGGACA No data
Right 914378801 1:147097921-147097943 CCAGTCTCATGCCTGCCAATGGG No data
914378794_914378802 12 Left 914378794 1:147097889-147097911 CCTGTCCCTCCAATGATAGGACA No data
Right 914378802 1:147097924-147097946 GTCTCATGCCTGCCAATGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914378794 Original CRISPR TGTCCTATCATTGGAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr