ID: 914381323

View in Genome Browser
Species Human (GRCh38)
Location 1:147119012-147119034
Sequence TTGTTTGCAGAGAATGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914381323 Original CRISPR TTGTTTGCAGAGAATGATGA AGG (reversed) Intergenic
901606706 1:10464796-10464818 TGGTATGCAGAGAGTGATGGAGG - Intronic
903187719 1:21638572-21638594 TTGTTTAAAGAGAAAGAGGACGG - Intronic
903933271 1:26876847-26876869 ATGGGTGCAGAGAATGCTGAGGG + Exonic
904279616 1:29409604-29409626 TTGTGGGGGGAGAATGATGAAGG + Intergenic
904740121 1:32667896-32667918 TTGTTCGGGGATAATGATGAGGG + Intronic
905929290 1:41775885-41775907 TTGTCTGCAGAGTAGGATGCTGG - Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
907337027 1:53706522-53706544 CTGGTTGCAGAAAATGCTGAAGG - Intronic
908598723 1:65716070-65716092 TTGTATACAGAGAAGGATAAGGG + Intergenic
908663816 1:66466961-66466983 TAGTTTGCTGAGAATGATGGTGG - Intergenic
909620772 1:77664146-77664168 TTGTTTAAATAGAATGATGATGG - Intronic
910006441 1:82403006-82403028 TTGTTTACTGAGTATGATGTTGG + Intergenic
911005264 1:93214265-93214287 TAGTTTGGAGAGAAAGACGATGG + Intronic
911589997 1:99736488-99736510 TAGTTTGCTGAGAATGATGTAGG - Intronic
911774858 1:101795977-101795999 TTATTTGTTGAGGATGATGAAGG + Intergenic
912571557 1:110628082-110628104 TTGTTTGGAGATGATGGTGATGG + Intronic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
914381323 1:147119012-147119034 TTGTTTGCAGAGAATGATGAAGG - Intergenic
915349982 1:155218212-155218234 CTGTTTGGAGAGACTGAAGACGG + Intergenic
917258287 1:173140029-173140051 TTCTTTGCTGAGAAAGGTGAGGG + Intergenic
917264531 1:173206561-173206583 TTCTTTGTAAAGAATGCTGAAGG - Intronic
918512226 1:185323807-185323829 TTGATTGCTGAGAATGAGCAAGG + Intergenic
919515297 1:198514868-198514890 TTGTTTGCTGAGAAAAATGATGG + Intergenic
919642540 1:200059432-200059454 TTGTTTGCTGAGAATAATTAGGG + Intronic
920111556 1:203590862-203590884 TGGTTTGCAGAGGATCCTGATGG + Intergenic
920923540 1:210319774-210319796 TTATTAGAAAAGAATGATGAAGG - Intergenic
921110771 1:212034836-212034858 TTGTCCGCAGAGAATGAGCAGGG + Intronic
921393465 1:214642202-214642224 TTGTTTGCAGAGAGCACTGAAGG - Exonic
921642648 1:217573964-217573986 TATTTTGCAGAGAATGAGAATGG + Intronic
922068528 1:222168245-222168267 TTGTGAGGAGAGAATGAAGATGG - Intergenic
922372562 1:224925944-224925966 TCATTTGAAGAGAATGTTGAAGG - Intronic
923729336 1:236535638-236535660 TTGTGTGTAGAGAATGGGGAAGG - Intronic
924446794 1:244140341-244140363 TTGTTTACAAATAATGAAGAAGG - Intergenic
1065166860 10:22988604-22988626 CTGAGTGCAGTGAATGATGATGG + Intronic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1069333184 10:67317953-67317975 TTGTTTGCATATAATCATAATGG + Intronic
1071134027 10:82432735-82432757 TTAGTTGCTGAGGATGATGATGG + Intronic
1073004873 10:100315548-100315570 TAGTTTGCTGAGAATGAAGAGGG + Intronic
1073113417 10:101076426-101076448 GAGTTTGGAGAGACTGATGAGGG + Intergenic
1073961313 10:108932701-108932723 TTGTTTACAGAAATAGATGATGG - Intergenic
1074733400 10:116401620-116401642 TGGTCTGGAGAGAATGAAGAAGG + Intergenic
1075644062 10:124086132-124086154 TTGTTGGCAGAGCATGATTGAGG - Intronic
1075966168 10:126613653-126613675 TTGTCTGCAGTGATTGAAGAGGG - Intronic
1077346563 11:2060375-2060397 TTGAATACAGAGATTGATGATGG - Intergenic
1078111138 11:8393601-8393623 TGGTTTACAGAGAATGATCGAGG + Intronic
1080338778 11:31232081-31232103 TTATTTGCAGATAATGAAAAAGG - Intronic
1081345218 11:41977297-41977319 TGGTTAGCTAAGAATGATGAAGG - Intergenic
1081821465 11:46000215-46000237 TTGTTTGCATAGCATAGTGAGGG - Intronic
1084344538 11:68536671-68536693 TTTTTTGGAGATAATGATAATGG + Intronic
1085590519 11:77755458-77755480 TTGTTTGTACATAAAGATGATGG + Intronic
1087690163 11:101311605-101311627 TTCTTTGAAGAGAATGATGGTGG + Intergenic
1087990189 11:104739953-104739975 TTGTTTGGATAGAAAGATTAAGG + Intergenic
1089638747 11:119833204-119833226 TTTTTTCCAGAGAGTGATGGGGG + Intergenic
1089862787 11:121604830-121604852 TTCTTTTCAGATAATGATTATGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091828828 12:3535048-3535070 TAGATGGCAGAGGATGATGATGG - Intronic
1091994798 12:4984998-4985020 TTGTTTGCAGTGGCAGATGATGG + Intergenic
1093194105 12:16109883-16109905 TTATTTGCAGAGAATGGACAAGG + Intergenic
1093228634 12:16515691-16515713 TTCTTTGCCGAGAAGGGTGAGGG - Intronic
1093277796 12:17151269-17151291 TTGTTTGAACTGAATGATAATGG + Intergenic
1094293932 12:28882242-28882264 TTGTCTGCAGAGCATGAGAAAGG - Intergenic
1095299082 12:40561278-40561300 TTCTGAGCAGAGAATTATGAAGG + Intronic
1096246039 12:49987230-49987252 TTGCTTGCAGAGATAGAAGAAGG - Intronic
1097065484 12:56317389-56317411 TGTTTTGCAAAGAATGAAGAAGG + Exonic
1097561687 12:61214685-61214707 TTGTTTACAGAAAATGGTCAAGG + Intergenic
1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG + Intergenic
1098657239 12:73047795-73047817 TTTTTTTCAATGAATGATGATGG + Intergenic
1099165379 12:79300248-79300270 ATGTTTGCAGAGAAAAATGCTGG - Intronic
1100458882 12:94779045-94779067 TTATTTGAAGATAATAATGATGG - Intergenic
1102676709 12:114664489-114664511 TTGTTCCCAGAGAGTGATGGGGG + Intergenic
1102770627 12:115473012-115473034 GTCATTGCAGATAATGATGAGGG + Intergenic
1104658031 12:130588414-130588436 CTGTTTGTAGTGAATGATGCTGG - Intronic
1106181412 13:27372604-27372626 TTGTTTTCAGAGAGAGAGGAAGG - Intergenic
1107272548 13:38637073-38637095 TTTCTGGCTGAGAATGATGAAGG + Intergenic
1108450469 13:50557571-50557593 TAGGTTGAAGAGAAAGATGAGGG - Intronic
1108819833 13:54335092-54335114 TTGTCTCCTGAGAATAATGATGG + Intergenic
1108823725 13:54386206-54386228 TTAATTGCTGAGAATGAAGATGG + Intergenic
1109402463 13:61853140-61853162 TTGTTTTCTGAGGATCATGAAGG - Intergenic
1110399887 13:75077565-75077587 GTTTTTGAAGGGAATGATGAGGG - Intergenic
1111841582 13:93456166-93456188 ATGTTTGCAATGAATGATTAAGG - Intronic
1113340475 13:109418978-109419000 ATGTTTGCAAAGAATGATAAGGG - Intergenic
1114487846 14:23074263-23074285 TTATTTTCAGACAATAATGAGGG + Intronic
1115156933 14:30351922-30351944 TTGTTTGCAGAATAAGAGGAAGG - Intergenic
1115767667 14:36640288-36640310 TTATTTGGGGAGAAAGATGAGGG - Intergenic
1116050297 14:39794612-39794634 TTGCTTGCAGGAAATTATGAAGG - Intergenic
1116759261 14:48990925-48990947 ATGTTTGCAGCAAATCATGAAGG - Intergenic
1116844801 14:49855267-49855289 TTTTTTGTAGAGATTGGTGAGGG - Intergenic
1117185480 14:53235632-53235654 TATATTGCAGAGGATGATGACGG + Intergenic
1118235141 14:63996306-63996328 TTCTTTTCTCAGAATGATGATGG + Intronic
1118511670 14:66481563-66481585 TATTTTGCAGAGAAGCATGATGG - Intergenic
1118776913 14:68979029-68979051 TGGTTTGCTGAGAATCATAATGG + Exonic
1119257579 14:73211792-73211814 ACTGTTGCAGAGAATGATGATGG + Exonic
1119585729 14:75833073-75833095 TTGGCTGAGGAGAATGATGAAGG - Intronic
1119974193 14:79007320-79007342 TTGATTGCAGTTGATGATGAGGG + Intronic
1120202941 14:81557555-81557577 TTGATTTAAGAGATTGATGAGGG - Intergenic
1120280117 14:82428765-82428787 TTGTTTACACAGAAAGGTGAGGG - Intergenic
1120320344 14:82951574-82951596 TTGATGTCATAGAATGATGATGG + Intergenic
1122619275 14:103045244-103045266 ATGTTTTTAGAGAATGATGAGGG + Intronic
1124954013 15:34348106-34348128 TTGTCTGGAGAGAATACTGAAGG - Exonic
1125701863 15:41693430-41693452 TAGTTTACTGAGAATGATGATGG + Intronic
1126056190 15:44731951-44731973 TTTTTTGCAGGGAATTATGGTGG - Intronic
1126650445 15:50915438-50915460 TGCTTTTCAGAAAATGATGAAGG + Exonic
1126664233 15:51061653-51061675 TTGGTTGTAGAGAATTATGATGG - Intronic
1127233210 15:57019170-57019192 TTGTTAGCAGACAATATTGAAGG + Intronic
1129926255 15:79366962-79366984 TCAGTTGCAGAGAATAATGATGG + Intronic
1130099769 15:80884254-80884276 TCTGTTGCAGTGAATGATGAAGG + Exonic
1130718042 15:86355893-86355915 ATGTTTGCAAAGAATGAAGCAGG - Intronic
1131350633 15:91696680-91696702 TCGTTTTAAGAGAAAGATGATGG - Intergenic
1131803145 15:96093319-96093341 TTGTTTGCACAGCATGACAATGG - Intergenic
1132113697 15:99120540-99120562 TTGTCTCCAGAGAAGGCTGAGGG - Intronic
1133143517 16:3766014-3766036 TTGTTTGAAGAGACTGATGGTGG + Intronic
1134511952 16:14855654-14855676 TAGCTTGCAGAGAAGGATGGGGG + Intronic
1134699593 16:16254154-16254176 TAGCTTGCAGAGAAGGATGGGGG + Intronic
1134868277 16:17628740-17628762 TCGCTTGCAGTGGATGATGATGG - Intergenic
1134972236 16:18540517-18540539 TAGCTTGCAGAGAAGGATGGGGG - Intronic
1137278747 16:46957016-46957038 TTGTTTGCAGAGTTTACTGATGG + Exonic
1137756415 16:50905953-50905975 TTATTTGGAAAGCATGATGATGG + Intergenic
1138808828 16:60124724-60124746 TGATTTGGAGATAATGATGAAGG - Intergenic
1138856881 16:60704938-60704960 ATGTTTGCAGAAAATGCAGAGGG - Intergenic
1140663749 16:77211282-77211304 TTGGTTGCAGGCAATGATAATGG - Intronic
1141206890 16:81939587-81939609 TTGTTTGCAGAGCAGGAAGGTGG - Intronic
1141358808 16:83375468-83375490 TTGTGTGCAGAGAAATATGTTGG + Intronic
1141890585 16:86924274-86924296 TTGGCTGCAGAGCACGATGATGG - Intergenic
1143825951 17:9607463-9607485 TTCTTTGGAGAGAATGGTGGGGG + Intronic
1143862485 17:9900988-9901010 TACTTTGGAAAGAATGATGATGG - Exonic
1144431602 17:15197497-15197519 TTGTTTACAGAGAGTCAAGAAGG - Intergenic
1146436754 17:32857074-32857096 GTGTTTACAGAGAAAGAAGATGG - Intronic
1146918948 17:36697034-36697056 TTGGGTGAAGAGCATGATGAGGG + Intergenic
1146960955 17:36978247-36978269 TTCTTTTAAGAGAATGATGTGGG - Intronic
1147570744 17:41569258-41569280 TTGTATGCAGTGAATGAAGATGG + Intronic
1148188278 17:45660417-45660439 TTGTTTGCAGAGACAGAACAGGG - Intergenic
1148581422 17:48746783-48746805 TTCTTTGGAGGGACTGATGAGGG + Intergenic
1149580722 17:57748708-57748730 TCATTTGCAGAGACAGATGAAGG - Intergenic
1150472038 17:65445793-65445815 TAGCTTGCTGAGAATGATGGAGG - Intergenic
1151016997 17:70566564-70566586 TAGTTTGCTGAGAATGATGTAGG + Intergenic
1151272773 17:73009645-73009667 TTGGTTGCAGAAAATTATGAAGG + Intronic
1153451120 18:5230366-5230388 TTCTTTGCAGTGAATGGTAATGG - Intergenic
1153469249 18:5425268-5425290 TTGTTTGTTGAGGATGATTAGGG + Intronic
1156195134 18:34766398-34766420 TAGTTTGCTGAGAATGATGTTGG - Intronic
1156676329 18:39530838-39530860 ATGTTTTCAGACAATGAGGAGGG - Intergenic
1158034855 18:53014561-53014583 TAGTTTGCTGAGAATGATGGGGG + Intronic
1158325010 18:56304129-56304151 ATGTTTGAAGAGAATGATTTGGG + Intergenic
1158550174 18:58429369-58429391 TTGGTTGTAGAGGATGAAGAGGG - Intergenic
1159408209 18:68034015-68034037 GAGTTTGCAGTCAATGATGACGG + Intergenic
1160257025 18:77255893-77255915 CTGTTTGCAGAGAATGCCCAGGG - Intronic
1164231915 19:23296881-23296903 TAGTTTGCTGAGGATGATGGAGG + Intergenic
1164390650 19:27817358-27817380 TAGTTTGCTGACAATGATGGAGG + Intergenic
1164469904 19:28521544-28521566 TTTTTTACACAGAATGGTGATGG + Intergenic
1165975343 19:39671569-39671591 TAGTTTGCTCAGAATGATGGGGG - Intergenic
1166767207 19:45258830-45258852 CTTTTTGTAGAGAAAGATGAAGG + Intronic
1168550751 19:57291296-57291318 TTGTGTGCAGTGAATGTGGAAGG + Exonic
925244995 2:2373987-2374009 TTATTTGCATAGAATGTTTATGG + Intergenic
925691684 2:6530734-6530756 TTGTTTGCAGGGAAGGCAGAAGG - Intergenic
925843771 2:8017607-8017629 TTGTCTGCAGACAGTGATGGTGG + Intergenic
926634253 2:15163659-15163681 TTGTCTACAGAGAATGTTAACGG + Intergenic
927330607 2:21858902-21858924 TAGTTACCAGAGGATGATGAGGG + Intergenic
929636728 2:43530336-43530358 TTGTTTGAACAGAATTATCAAGG + Intronic
930335663 2:50042164-50042186 ATATTTGCAGAGAATAAAGATGG - Intronic
930580098 2:53200915-53200937 TTCTCTGCTGAGACTGATGATGG - Intergenic
931351453 2:61492986-61493008 TTGGTTGTAGAGAATGATCAAGG - Exonic
932050456 2:68393098-68393120 TTGTTTGTACAGAGTGATGCTGG + Intronic
932362601 2:71121443-71121465 TGGAGGGCAGAGAATGATGATGG + Intronic
933151163 2:78916952-78916974 TTGTTTGCTGAGACTGACAAAGG - Intergenic
933184787 2:79267123-79267145 TTCTGTGCAGAGAAATATGAGGG - Intronic
933527958 2:83467845-83467867 TTGACTGAAAAGAATGATGAGGG - Intergenic
934216580 2:90036960-90036982 TTCTTTCCTGAGACTGATGATGG + Intergenic
934545348 2:95209808-95209830 TTGTTTGTACAGAACGAAGATGG + Intronic
934605308 2:95690705-95690727 TGTTTTCCAGAGAGTGATGAAGG + Intergenic
936279282 2:111123266-111123288 TTGTTTGCCGAAAATGCTGAGGG - Intronic
936538765 2:113333258-113333280 TGTTTTCCAGAGAGTGATGAAGG + Intergenic
939063181 2:137449286-137449308 ATGTTTGTGTAGAATGATGAAGG + Intronic
939233237 2:139458076-139458098 TTGTCTAGAGAGAATAATGAAGG - Intergenic
939842231 2:147203169-147203191 TTCTTTGCAAAGGAAGATGATGG - Intergenic
940127298 2:150340926-150340948 TTTTTTGCAGAGAGTATTGATGG + Intergenic
940184054 2:150962928-150962950 CAGTTTGCTGAGAATGATGGAGG - Intergenic
941269422 2:163407306-163407328 ATGCTTGTAGACAATGATGAAGG + Intergenic
943914660 2:193614633-193614655 TAGTTTGCTGAGAATAATGGTGG + Intergenic
946912339 2:224476693-224476715 TTGTATAGAGAGTATGATGATGG - Intronic
947330080 2:229019614-229019636 TTGCTTCCAGAGAATAAAGAAGG + Intronic
947906214 2:233765202-233765224 ATGTTTGCAAAGAATACTGAGGG - Intronic
948159220 2:235810514-235810536 TAGATTGCAGAGAGTGTTGAAGG - Intronic
1169185725 20:3615762-3615784 TAGTTTGCTGAGAATGATGGGGG - Intronic
1169395573 20:5225971-5225993 TAGTTTGCTGACAATGATGATGG + Intergenic
1169563764 20:6830046-6830068 TTGCTTTCAGAGAAACATGAAGG - Intergenic
1169594725 20:7185119-7185141 TAGTTTGCTGAGAATGATGGAGG - Intergenic
1169956191 20:11105587-11105609 ATGTTTGCGGAGAATGGAGAAGG + Intergenic
1172453070 20:35042487-35042509 CTGTTTTCAGAGCATGATTAGGG + Intronic
1174481078 20:50831901-50831923 TTGTCAGCAGAGAATGAAGCAGG + Intronic
1174570436 20:51497526-51497548 TTGTTTGCAGGGATTGAACAAGG - Intronic
1174686673 20:52462869-52462891 GAGTTTGCAGAGAAAGACGATGG - Intergenic
1175651950 20:60732785-60732807 TTGTCTGCAGGGAAGGATTAAGG + Intergenic
1176349382 21:5779784-5779806 TTAGTTGCAGAGGATGATGGAGG - Intergenic
1176356196 21:5900368-5900390 TTAGTTGCAGAGGATGATGGAGG - Intergenic
1176543703 21:8177854-8177876 TTAGTTGCAGAGGATGATGGAGG - Intergenic
1176562654 21:8360899-8360921 TTAGTTGCAGAGGATGATGGAGG - Intergenic
1177700921 21:24638128-24638150 TTCTTTCCAGATAATGATTATGG - Intergenic
1178428058 21:32494945-32494967 TTATTTACAGAGAATGCTGTAGG + Intronic
1178800884 21:35794421-35794443 TAGTTTGCTGAGAATGATGGAGG + Intronic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1184981982 22:48101423-48101445 ATGTTTGCAGAGAGTGGTGCAGG - Intergenic
1185214802 22:49592567-49592589 TTCTTTGCATTGAGTGATGATGG - Intronic
1203248571 22_KI270733v1_random:94076-94098 TTAGTTGCAGAGGATGATGGAGG - Intergenic
949224468 3:1677420-1677442 TTGTTTGAATTAAATGATGAAGG - Intergenic
949472417 3:4410423-4410445 TTGTTTGGAGAGAAAGAGAAAGG - Intronic
949817850 3:8079398-8079420 AGTTTTTCAGAGAATGATGATGG + Intergenic
949902528 3:8829318-8829340 ATGGCTGCAGAGAATAATGAGGG + Intronic
950249033 3:11448629-11448651 TTGACTGAAGAGAATGATGGAGG + Intronic
951094500 3:18612663-18612685 AGTTCTGCAGAGAATGATGATGG - Intergenic
951916945 3:27811211-27811233 AAGGTTGCAGAGATTGATGAGGG - Intergenic
952249542 3:31638014-31638036 TTGTTTCCTGAGAAAGGTGAGGG - Intergenic
955979006 3:64505969-64505991 TAGTTTGCTGAGAATGATGCAGG - Intergenic
956008439 3:64805165-64805187 TTTCGTGCAGAGAATGAAGAGGG - Intergenic
956101453 3:65772500-65772522 TTCTCTGCAGAGAATGATCATGG + Intronic
956636701 3:71371938-71371960 TTTCCTGCAGAGAATGAAGAGGG - Intronic
956744182 3:72298568-72298590 TTGTGGGGAGAGAGTGATGAGGG + Intergenic
957585167 3:82123656-82123678 TTGTTTGCAAAGAAAGGGGAAGG - Intergenic
957647361 3:82949292-82949314 ATGTTTTCAGAGATTGATGTGGG - Intergenic
960093009 3:113660862-113660884 ATGTGTGCAAAGAATGATGTTGG + Exonic
960212278 3:114984443-114984465 TTGTTCACAGAAAATGGTGACGG - Intronic
960704994 3:120473348-120473370 TTTCTTGCAGGGAGTGATGAAGG + Intergenic
960747409 3:120905587-120905609 CAGTTTGCAGTGAATGATAAGGG + Intergenic
962033422 3:131625271-131625293 TTGTTTAGAGAGAATGGAGAAGG - Intronic
963882520 3:150545362-150545384 TTCTTTGCAAAGACTGATAATGG + Intronic
963920865 3:150903406-150903428 ATATTTGCACAGAATCATGAAGG - Exonic
964877678 3:161387162-161387184 TTCTTTGCACAAAATGATAAAGG - Intergenic
965083735 3:164067386-164067408 ATGGGTGCAGAGGATGATGAGGG + Intergenic
965289586 3:166862150-166862172 TAATTGGGAGAGAATGATGATGG - Intergenic
967545814 3:190726014-190726036 TTGTTTGCAGAGAATATTTGGGG - Intergenic
967640365 3:191855514-191855536 TTATATGCAGAGAAGGATGTAGG - Intergenic
968484131 4:850592-850614 GTGTTTGCAGAGACTGTTGAGGG - Intronic
969138864 4:5051894-5051916 GTGTTTGACGAGAATGAGGAAGG + Exonic
971242796 4:24903713-24903735 TTGGCTGCAGAGAAACATGAGGG - Intronic
972158156 4:36190725-36190747 ATGTTTGCACAGAATGTTGATGG + Intronic
972169255 4:36324921-36324943 ATGATTGCAGAGAATGTTTAGGG + Intronic
972348930 4:38217840-38217862 TTTTTTGCTAAGATTGATGATGG + Intergenic
972777796 4:42259152-42259174 GTTTGTGCAGAGTATGATGATGG - Intergenic
973278854 4:48338739-48338761 TTGTTTGAAGAAAATCAGGAAGG + Intergenic
974173801 4:58299530-58299552 TTATTTGGGTAGAATGATGAGGG - Intergenic
974195003 4:58562455-58562477 GTGTTTGCTGAAAATGATAAAGG + Intergenic
975172707 4:71250704-71250726 TTGTTAGCAGCCAATGAGGAAGG + Intronic
975647307 4:76557973-76557995 TTGTGTCCAGAGAGTGCTGAAGG + Intronic
976543564 4:86306460-86306482 TTGTTTGCAAAGTATGATTTGGG - Intronic
977597898 4:98903765-98903787 ATGTTTACACAGAATGATTAAGG + Intronic
978150864 4:105433114-105433136 TTGTTTACTGAGAATGGTAAGGG - Intronic
978950015 4:114546818-114546840 ATGTTTGCAGGCAATAATGAAGG + Intergenic
978996087 4:115155044-115155066 TTCTGTGCAGAGAATGGTGGAGG - Intergenic
980304325 4:131037771-131037793 TTGTTTGGAGAGAAAGAAGTAGG - Intergenic
981187594 4:141822145-141822167 TTGTTTGAAGAGAAAAATGGGGG + Intergenic
983186168 4:164703236-164703258 TTGTTTGCAGTTAATGATTCTGG + Intergenic
983397777 4:167223959-167223981 ATGGCTGTAGAGAATGATGATGG - Intronic
983429136 4:167625570-167625592 TTGTTTATATAGAATGAGGAGGG - Intergenic
983747253 4:171217121-171217143 TTGTTTTCTGAGAATGGTGTTGG - Intergenic
984176427 4:176423988-176424010 TTGTTTGCTCAGAATTATGAGGG - Intergenic
986318619 5:6609399-6609421 TTGGCTGCAAGGAATGATGACGG - Intronic
987075652 5:14379727-14379749 TTGTTGGCAGAGAAAGATAATGG + Intronic
987158226 5:15112905-15112927 ATATGTGCAGAGAATGATGCAGG + Intergenic
987336283 5:16900676-16900698 TAGTTGGCATAGAATGAAGAGGG - Intronic
987351315 5:17024698-17024720 ATGTGTGCAGAGAATAAAGAAGG + Intergenic
988369600 5:30349110-30349132 TTTTTTGCATAGAATTATAAAGG + Intergenic
988387293 5:30581487-30581509 TTGTTTGCAGAGAATAAGTTGGG - Intergenic
988938760 5:36119315-36119337 TTGTTTGAAGACAAGGATGCTGG - Intronic
990830274 5:59948483-59948505 TTTTATGCTGAGAATGATAATGG + Intronic
994626330 5:102224716-102224738 TAGTCTGCAGTGAACGATGAGGG + Intergenic
995042643 5:107606426-107606448 TAGATGGCAGAGAATGAGGAAGG - Intronic
995704117 5:114968125-114968147 TTGTCTACTGTGAATGATGATGG - Intergenic
997944633 5:138189030-138189052 TTGTTAGCAGAGAGTGAAGCAGG + Exonic
999532114 5:152475370-152475392 TTTTTTGTACAGAATGCTGAGGG - Intergenic
999793213 5:154962822-154962844 TTATTGGCTGAGAGTGATGAAGG + Intronic
999813068 5:155146450-155146472 TTATTTGCAGAGCCTGTTGAAGG - Intergenic
1001084210 5:168688498-168688520 TGGTTGGCAGAGCATGATGCAGG + Intronic
1001672538 5:173486046-173486068 TAGTTTGCTGAGAATGATGGGGG + Intergenic
1003044613 6:2721956-2721978 TAGTTTTCTGAGAATGATGGAGG - Intronic
1003698471 6:8436302-8436324 CTGTTTTCAGAGAATAATTAAGG + Intergenic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1005942681 6:30572388-30572410 TGGTTGTCAGAGTATGATGAAGG + Intronic
1006336399 6:33423170-33423192 TTGGGGGCAGAGAAAGATGAAGG - Intronic
1006528025 6:34625055-34625077 CTCTTTGGAGAGAATGTTGATGG - Intronic
1010903920 6:81462183-81462205 GTTTTTGCGAAGAATGATGATGG + Intergenic
1010971130 6:82264482-82264504 TTGTCAGTACAGAATGATGAAGG - Intergenic
1011810449 6:91126772-91126794 TTTATTGTAGAGAATGATAAAGG + Intergenic
1012477847 6:99634675-99634697 GTATTTGAAGGGAATGATGATGG + Intergenic
1013492998 6:110668292-110668314 TTGTTTGCATAGGATTTTGATGG - Intronic
1014089207 6:117384626-117384648 TATTTTGAAGAGAAAGATGATGG - Intronic
1014425452 6:121299943-121299965 TGGTTGGCAGAAAATGATTAGGG - Intronic
1014482108 6:121951460-121951482 TTATTTGCAGAGGATGATGGTGG - Intergenic
1014556406 6:122846115-122846137 ATGTTTTCAGAAAATGCTGAGGG - Intergenic
1015375439 6:132504801-132504823 TTCTTTCCAGACAAGGATGATGG - Intronic
1017329803 6:153183140-153183162 TTGTTAGCTGAGAGTGAGGATGG + Intergenic
1019069286 6:169328932-169328954 TTGTTTTCAGAGAAGAATGCTGG - Intergenic
1019182056 6:170193603-170193625 TTGTTGGCAGAGCCTCATGAGGG - Intergenic
1021013273 7:15498506-15498528 TTGTGTGCACAGAATAAAGAAGG + Intronic
1022143778 7:27516399-27516421 TTGCTTGCTGTAAATGATGAAGG - Intergenic
1023276443 7:38523464-38523486 ATGTTGTCAGAGAATGATGCAGG + Intronic
1023484189 7:40666517-40666539 ATGTTTTCAAAGAATGAAGAAGG + Intronic
1023973274 7:45007699-45007721 TTGTTTGCAGCTTAGGATGATGG + Intronic
1024418254 7:49133530-49133552 GTGTTCTCAGAGAATGCTGAGGG - Intergenic
1024514876 7:50240083-50240105 AGTTTTGCAAAGAATGATGATGG - Intergenic
1024833516 7:53489393-53489415 TTGTTTTCATAGAATGATACAGG + Intergenic
1025870511 7:65428187-65428209 TAGTTTGCTGAGGATGATGGAGG - Intergenic
1027466485 7:78521633-78521655 TTGTTTGCAGACAATTACTACGG - Exonic
1027847823 7:83406049-83406071 TGGTTTTCACAGAATGATGTAGG - Exonic
1028025322 7:85829857-85829879 TTGTTTGCCCAGAATGAGCATGG + Intergenic
1028399678 7:90411266-90411288 TTTTGTTCAGAGCATGATGAAGG - Intronic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1028470258 7:91198072-91198094 ATGTCTGCAGACAGTGATGAGGG - Intronic
1029373099 7:100161805-100161827 TAGTTTGCTGAGCATGATGATGG - Intronic
1029591596 7:101510683-101510705 TTTTTTGTAGAGAATGAGGCTGG + Intronic
1029919773 7:104250870-104250892 TTGGATGCAGAGGATGAAGATGG + Intergenic
1030399061 7:109025975-109025997 TCTTTTCCACAGAATGATGAAGG + Intergenic
1031428805 7:121639877-121639899 ATGTTTGCTGATAATGATAATGG - Intergenic
1033159580 7:138983556-138983578 GAGTTTGCAGAGAATGGAGAAGG - Intergenic
1033334838 7:140443746-140443768 GTGTGTGTTGAGAATGATGAGGG - Intergenic
1033400585 7:141020031-141020053 TTGTTTTCAGAAAAAGAAGAAGG + Intergenic
1035846263 8:2868168-2868190 TTGTCTGTTGAGAATGAGGATGG - Intergenic
1036077817 8:5521013-5521035 TTGTTTCCAGAGTTAGATGACGG + Intergenic
1036660955 8:10708331-10708353 TTGTTGACAGAGACTGTTGATGG + Intronic
1036825505 8:11972767-11972789 TTCTTAGTAGAGAATGAGGAGGG + Intergenic
1037170722 8:15888360-15888382 TTTTTTTCAGAGAATCACGAAGG - Intergenic
1037359683 8:18060052-18060074 TAGTTTGCTGAGGATGATGGTGG + Intronic
1038943802 8:32335128-32335150 TAATTTGCAGAGAATGATTTTGG + Intronic
1041020105 8:53630141-53630163 TTGTTTTTAGTGAATGATGCTGG - Intergenic
1043496439 8:80805940-80805962 CTGTTTGAAGACACTGATGATGG - Intronic
1043523761 8:81074081-81074103 TTATTAGCTGAGAATGAGGATGG + Intronic
1043784298 8:84378182-84378204 TAGTTTGCAGAGAATTAAGAAGG - Intronic
1043861711 8:85325118-85325140 TTGGATGCAGAGAATATTGATGG + Intergenic
1044652078 8:94506518-94506540 TTTCTTGCAGAGCATGATTATGG - Exonic
1045179808 8:99768254-99768276 TTGTTTCCAGGGAAAGAAGAAGG - Intronic
1045541319 8:103088809-103088831 TTGTTTGTTGAGACTGATGAAGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1046456237 8:114466435-114466457 TTGTTTTATTAGAATGATGAAGG + Intergenic
1048029158 8:130614568-130614590 TTGTTTGCAAAGCAGAATGAGGG - Intergenic
1048151138 8:131895781-131895803 TTATTTTCTGAGAAAGATGAAGG + Intergenic
1048167390 8:132075628-132075650 TTGTTGGCAGTGAAGGAGGAAGG - Intronic
1048316137 8:133363775-133363797 AGGTTTGCAGAGAATTTTGATGG - Intergenic
1048669999 8:136707690-136707712 TAGTTTGCTGAGAATGATGGTGG + Intergenic
1049131748 8:140850809-140850831 TCTATTGCAGAGTATGATGAAGG - Intronic
1050409816 9:5351303-5351325 TCCTTTGCAGAGAATGCTGCTGG + Intergenic
1050941836 9:11470767-11470789 TTGTATGCAGAAAATCATAAAGG + Intergenic
1050984071 9:12059837-12059859 TCATTTGCAGTGAATGTTGAGGG - Intergenic
1051560936 9:18439179-18439201 TTGTTTCTAGACCATGATGAGGG - Intergenic
1053317951 9:37068556-37068578 TGGTTGTCAGAGAATGAGGAAGG + Intergenic
1056925439 9:90830447-90830469 TTGTTTGCAGAGCCTGGTGCTGG + Intronic
1058066144 9:100550112-100550134 TTGTTGGGAAAGAAAGATGATGG + Exonic
1059286286 9:113174617-113174639 TTGTTAACAGAGAATAAAGAGGG + Intronic
1059788745 9:117616705-117616727 TTGTTTCCAGAGAGAGATAAGGG - Intergenic
1061423757 9:130486508-130486530 TACTCTGCAGAAAATGATGACGG + Intronic
1203464972 Un_GL000220v1:77324-77346 TTAGTTGCAGAGGATGATGGAGG - Intergenic
1203374402 Un_KI270442v1:352216-352238 TAGTTTACTGAGAATGATGGTGG + Intergenic
1187415871 X:19092880-19092902 TTCTTTGCAGGGAGTGAGGAGGG - Intronic
1187742580 X:22372592-22372614 GTGTTTCCATAGAAGGATGATGG + Intergenic
1188108529 X:26170103-26170125 TTGTGTACAAAGACTGATGAAGG + Intergenic
1190635487 X:52428851-52428873 TTGTATTCAGAGAATGATGGTGG - Intergenic
1190639463 X:52468837-52468859 CTGTATTCAGAGAATGATGGTGG - Intergenic
1191030377 X:55963220-55963242 TTCTTTGCTGAGAAAGGTGATGG - Intergenic
1192461635 X:71322054-71322076 TAGTTTGAAGAGAAAGAGGAAGG + Intergenic
1194703005 X:97137503-97137525 ATGTTTACAGTGAATGAAGATGG + Intronic
1197059986 X:122166221-122166243 TTGTTATCAGAAAATGAGGATGG + Intergenic
1197134211 X:123041918-123041940 TTGATTGCAGAAAATGATGCAGG + Intergenic
1198015463 X:132605957-132605979 TAGTTTGCTGAGAATGACAAGGG - Intergenic
1198462216 X:136874648-136874670 TTGTTTGAAAAGACTGAAGACGG + Intronic
1199091017 X:143692469-143692491 TTTTTTGCAGAGAAACCTGATGG - Intergenic
1199852265 X:151733637-151733659 TTATTTGCACACACTGATGAGGG - Intergenic
1200736363 Y:6801025-6801047 TTGTTACCAGAGAATGAGCAAGG - Intergenic
1201038424 Y:9805707-9805729 TTTTTTGCAGGGGAAGATGATGG - Intergenic
1201262525 Y:12174146-12174168 TTTTTTGTAGAGATTGGTGAGGG - Intergenic
1202147188 Y:21810690-21810712 TTTTTTGCTGAAAATGATGAAGG + Intergenic