ID: 914383362

View in Genome Browser
Species Human (GRCh38)
Location 1:147141461-147141483
Sequence GGGTTATATTTTTAACTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914383357_914383362 9 Left 914383357 1:147141429-147141451 CCTTTGGATATATACTCAGAAGA No data
Right 914383362 1:147141461-147141483 GGGTTATATTTTTAACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914383362 Original CRISPR GGGTTATATTTTTAACTTCT TGG Intergenic
No off target data available for this crispr