ID: 914385010

View in Genome Browser
Species Human (GRCh38)
Location 1:147160252-147160274
Sequence TGGAATTGATCCATTGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914385010_914385017 12 Left 914385010 1:147160252-147160274 CCCAATCCAATGGATCAATTCCA No data
Right 914385017 1:147160287-147160309 AATATGAGAGAATCAGGAATGGG No data
914385010_914385016 11 Left 914385010 1:147160252-147160274 CCCAATCCAATGGATCAATTCCA No data
Right 914385016 1:147160286-147160308 CAATATGAGAGAATCAGGAATGG 0: 1
1: 0
2: 2
3: 29
4: 308
914385010_914385015 6 Left 914385010 1:147160252-147160274 CCCAATCCAATGGATCAATTCCA No data
Right 914385015 1:147160281-147160303 CTAAACAATATGAGAGAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914385010 Original CRISPR TGGAATTGATCCATTGGATT GGG (reversed) Intronic
No off target data available for this crispr