ID: 914387004

View in Genome Browser
Species Human (GRCh38)
Location 1:147179485-147179507
Sequence CTTTGGATTTAGCTTCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 2, 1: 0, 2: 1, 3: 23, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914387004_914387006 -9 Left 914387004 1:147179485-147179507 CCAACAAGAAGCTAAATCCAAAG 0: 2
1: 0
2: 1
3: 23
4: 208
Right 914387006 1:147179499-147179521 AATCCAAAGAAATATGAAGGTGG 0: 1
1: 0
2: 5
3: 44
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914387004 Original CRISPR CTTTGGATTTAGCTTCTTGT TGG (reversed) Intronic