ID: 914387006

View in Genome Browser
Species Human (GRCh38)
Location 1:147179499-147179521
Sequence AATCCAAAGAAATATGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 364}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914387004_914387006 -9 Left 914387004 1:147179485-147179507 CCAACAAGAAGCTAAATCCAAAG 0: 2
1: 0
2: 1
3: 23
4: 208
Right 914387006 1:147179499-147179521 AATCCAAAGAAATATGAAGGTGG 0: 1
1: 0
2: 5
3: 44
4: 364
914387003_914387006 -5 Left 914387003 1:147179481-147179503 CCAGCCAACAAGAAGCTAAATCC 0: 2
1: 0
2: 1
3: 28
4: 99
Right 914387006 1:147179499-147179521 AATCCAAAGAAATATGAAGGTGG 0: 1
1: 0
2: 5
3: 44
4: 364
914387002_914387006 9 Left 914387002 1:147179467-147179489 CCATATACTTCTCTCCAGCCAAC 0: 2
1: 0
2: 0
3: 12
4: 198
Right 914387006 1:147179499-147179521 AATCCAAAGAAATATGAAGGTGG 0: 1
1: 0
2: 5
3: 44
4: 364
914387001_914387006 13 Left 914387001 1:147179463-147179485 CCTACCATATACTTCTCTCCAGC 0: 2
1: 0
2: 3
3: 22
4: 232
Right 914387006 1:147179499-147179521 AATCCAAAGAAATATGAAGGTGG 0: 1
1: 0
2: 5
3: 44
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914387006 Original CRISPR AATCCAAAGAAATATGAAGG TGG Intronic