ID: 914390977

View in Genome Browser
Species Human (GRCh38)
Location 1:147222971-147222993
Sequence AACATGTAACACTATGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914390973_914390977 4 Left 914390973 1:147222944-147222966 CCATCCTAGGCCTACTGAATAAT 0: 1
1: 1
2: 3
3: 54
4: 411
Right 914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
914390974_914390977 0 Left 914390974 1:147222948-147222970 CCTAGGCCTACTGAATAATAACC No data
Right 914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
914390975_914390977 -6 Left 914390975 1:147222954-147222976 CCTACTGAATAATAACCAACATG 0: 1
1: 0
2: 0
3: 14
4: 197
Right 914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
914390970_914390977 19 Left 914390970 1:147222929-147222951 CCACATGTGTGAGTCCCATCCTA 0: 1
1: 0
2: 0
3: 15
4: 99
Right 914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 163
914390972_914390977 5 Left 914390972 1:147222943-147222965 CCCATCCTAGGCCTACTGAATAA 0: 1
1: 2
2: 37
3: 189
4: 680
Right 914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914390977 Original CRISPR AACATGTAACACTATGTTCC TGG Intronic
903469558 1:23576408-23576430 TTCATGTAACACTATGTGCCAGG + Intergenic
904705207 1:32384818-32384840 TACCTGTAACAATATGTGCCAGG - Intronic
905477737 1:38240688-38240710 AACATGTGCCACTATGACCCAGG + Intergenic
905830118 1:41059108-41059130 GCCATGTAACACCATCTTCCAGG - Intronic
908120753 1:60983988-60984010 AACATTTAACCCTATGTTTAAGG - Intronic
908559773 1:65293942-65293964 AACATAAATTACTATGTTCCAGG + Intronic
908582726 1:65533132-65533154 AACATCTAACAAGATGTTCAGGG + Intronic
912053712 1:105567835-105567857 AATATGTAACAATATGTGGCAGG - Intergenic
912913446 1:113787123-113787145 AACATATATTACTGTGTTCCTGG - Intronic
913897253 1:124432028-124432050 GACATGTAACACTCTTTTTCTGG + Intergenic
914390977 1:147222971-147222993 AACATGTAACACTATGTTCCTGG + Intronic
914986195 1:152459132-152459154 ACCATGGAAAACTGTGTTCCAGG - Intergenic
917310957 1:173677704-173677726 TACTTGTAACACTAAGTTACAGG - Intergenic
919402577 1:197138165-197138187 AACATGTAACATCATGTTAAAGG - Intronic
919632734 1:199974723-199974745 AACATGAAGATCTATGTTCCTGG + Intergenic
921534312 1:216326625-216326647 TACACCTAACACTGTGTTCCAGG + Intronic
924898282 1:248366728-248366750 AACATGTAACATAATGGGCCTGG + Intergenic
1065065080 10:21954375-21954397 AGCATCTAACACTATGTTGCAGG + Intronic
1065789070 10:29243140-29243162 AAGATGTAGCACTATAATCCTGG + Intergenic
1069149814 10:64945865-64945887 AAAATATAACCCTATGTTCTTGG - Intergenic
1073602034 10:104855447-104855469 AAGATGTACCACCATGTTCATGG - Intronic
1075360462 10:121827741-121827763 TACATGTAAGACTATGGTCATGG + Intronic
1077244267 11:1528551-1528573 GACATGTAACACCAAGTCCCAGG + Intergenic
1078286893 11:9965797-9965819 ATCATGTAACATTAATTTCCTGG + Intronic
1078979299 11:16514255-16514277 AACATGTAACAATATGTACATGG - Intronic
1079762274 11:24344198-24344220 AGCCTGTAACATAATGTTCCAGG + Intergenic
1080912474 11:36616820-36616842 AAAATTTAAAACTCTGTTCCTGG - Intronic
1080932837 11:36830733-36830755 ACCATGTTCCAGTATGTTCCAGG + Intergenic
1085282402 11:75339906-75339928 GACATGGAACACTATCTCCCCGG - Intronic
1085314706 11:75537497-75537519 CACATGTAGCACGATGTTCCGGG - Intergenic
1087277937 11:96179123-96179145 AACATGCAGCACTATGTTGCTGG - Intronic
1088444679 11:109912916-109912938 AACACTTAACACTATGTACTTGG - Intergenic
1096012690 12:48234447-48234469 AACATATAACTCTTTGTTTCAGG - Intergenic
1096135841 12:49199888-49199910 CTCATATAACACTGTGTTCCAGG + Intronic
1096276512 12:50213363-50213385 ACCATATAACACTATCTTCATGG - Intronic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1099108989 12:78533058-78533080 AACATGGAACAGAATGTTCTTGG + Intergenic
1102956148 12:117060341-117060363 AACATGCAACAGAATGTTCCCGG - Intronic
1105699483 13:22925804-22925826 TACATATAACACCATGTCCCGGG - Intergenic
1105851188 13:24338344-24338366 TACATATAACACCATGTCCCGGG - Intergenic
1107381835 13:39864737-39864759 AATATGTCAAACAATGTTCCAGG - Intergenic
1108521083 13:51247493-51247515 AACATGTCACCCTGTGTACCTGG + Intronic
1109682473 13:65771227-65771249 AACCTGAAAAACTATATTCCTGG + Intergenic
1114696321 14:24630708-24630730 AACATGGACCACTTTGGTCCTGG - Intergenic
1115261021 14:31454338-31454360 AACATTCAACTATATGTTCCAGG + Intronic
1116068958 14:40018370-40018392 AGCCTGTAACACTAACTTCCTGG - Intergenic
1116288442 14:43003050-43003072 ACCCTGGAAGACTATGTTCCTGG - Intergenic
1121547961 14:94776393-94776415 GACATGTAACACTGTCTCCCAGG - Intergenic
1122840560 14:104460780-104460802 TACATTTAACACGATGTCCCGGG - Intergenic
1125616038 15:41014232-41014254 AACATGTAAGACTATAGTCTTGG + Intronic
1125788522 15:42344112-42344134 AACATGTAAAGCTATGTTGAGGG - Intronic
1126240054 15:46431500-46431522 AATATGTAACATTTTGTTACTGG - Intergenic
1127930146 15:63590373-63590395 AACATGGAAAACTAGGTACCAGG - Intronic
1130064825 15:80594814-80594836 ACCATGAAACACTTTCTTCCAGG + Exonic
1131706570 15:95002443-95002465 AGTATGTAACCCTGTGTTCCGGG - Intergenic
1135997801 16:27265892-27265914 AACAAGTAACACAATATTCAGGG + Intronic
1140831461 16:78755404-78755426 AACATGTAATATCATGGTCCAGG - Intronic
1143986939 17:10922948-10922970 AACAAGTAACAGTGTGTTACTGG - Intergenic
1145126952 17:20309316-20309338 AACATATAAGACAATTTTCCTGG - Intronic
1145924605 17:28636852-28636874 AACATGTGACACTCTGTTTTGGG + Intronic
1146415472 17:32628338-32628360 AACATGAAACATTAAGTTACGGG - Intronic
1149999873 17:61427308-61427330 AACATATAACACAAAGATCCAGG + Intergenic
1153714173 18:7829366-7829388 AGAATGTAACAGTATTTTCCTGG - Intronic
1157462640 18:47913672-47913694 AACAGATAACAATGTGTTCCAGG + Intronic
1159268580 18:66118567-66118589 AAAATTTAACTATATGTTCCTGG - Intergenic
1160133439 18:76250446-76250468 AACATGTACAAGTATGTGCCTGG + Intergenic
1165618400 19:37222757-37222779 GACATGTAAAAGAATGTTCCCGG - Intronic
926860925 2:17307928-17307950 AACATGGATCAAGATGTTCCTGG - Intergenic
926947663 2:18205761-18205783 GACATGTACCACTATGGTGCAGG - Intronic
927267511 2:21168779-21168801 TACATGTAAGAACATGTTCCAGG + Intergenic
929447530 2:42013080-42013102 AACATGTTACTTTAGGTTCCAGG - Intergenic
931965495 2:67529197-67529219 AACATGTACCACTGTGGTGCAGG + Intergenic
932907306 2:75767807-75767829 AACATGTATCAATATGTACCTGG + Intergenic
934621473 2:95811769-95811791 TACATGTAAAATTATGTGCCTGG + Intergenic
934811970 2:97287046-97287068 TACATGTAAAATTATGTGCCTGG - Intergenic
934825723 2:97420881-97420903 TACATGTAAAATTATGTGCCTGG + Intergenic
935914476 2:107934795-107934817 AACATGTCACCCTATTTTCTAGG - Intergenic
935919173 2:107991808-107991830 AAAATGTAACATTATGTTTGTGG - Intronic
938622972 2:133076655-133076677 ATCATGTACCACTATCATCCAGG - Intronic
938702154 2:133889058-133889080 AATATTTAACACTACATTCCAGG + Intergenic
939682410 2:145154707-145154729 AAAATGTAACTGGATGTTCCTGG - Intergenic
939995741 2:148917657-148917679 AATAAGTAACTCTGTGTTCCAGG - Intronic
940425012 2:153521491-153521513 AACATGTACCACTCTGGTACGGG - Intergenic
1169683778 20:8247680-8247702 AGCATTTACTACTATGTTCCAGG - Intronic
1170330353 20:15202938-15202960 AAAATGTAACATTTTATTCCTGG + Intronic
1175107052 20:56622938-56622960 AACATGTAACACAGTGGGCCGGG - Intergenic
1175489067 20:59366428-59366450 ATCAAGTATCATTATGTTCCAGG + Intergenic
1179773316 21:43641484-43641506 AACAAGGAAGACTTTGTTCCTGG - Intronic
1180540304 22:16440153-16440175 AACATGAAAAATTTTGTTCCAGG + Intergenic
1184116135 22:42423417-42423439 AACATGTTTCACTCTGTTACTGG - Intronic
952033440 3:29172160-29172182 AACCTATAACACTATGTTTTTGG + Intergenic
953211298 3:40877642-40877664 AAAAGCTAACCCTATGTTCCAGG + Intergenic
954109859 3:48427946-48427968 AACATGAAACAGTGTGTGCCTGG + Intronic
957648925 3:82973883-82973905 AACATGTAACACTGACTTCTTGG + Intergenic
959672022 3:108989756-108989778 CACAGTTAACATTATGTTCCAGG + Intronic
960469946 3:118050257-118050279 ACCATGGAATACTATGTTACAGG + Intergenic
961845168 3:129756737-129756759 AACATGTAACACTTTGAGTCTGG - Intronic
965878912 3:173364501-173364523 AAAATGTAAAACTAGGTTTCTGG - Intergenic
966359259 3:179116836-179116858 TACATGAAACACTATTTTCTTGG - Intergenic
966389828 3:179440435-179440457 TACATGAAACACTATTTTCTTGG - Intronic
967191211 3:186986339-186986361 AATATTCAACACTATGTGCCAGG - Intronic
969181458 4:5445441-5445463 AACATTTCACAAAATGTTCCTGG + Intronic
969698706 4:8752911-8752933 AACATGTGACAGTATTTCCCTGG - Intergenic
971441006 4:26685483-26685505 CACATGTGTCACTATGTTGCTGG - Intronic
971562436 4:28097614-28097636 AACATGTAATTCTATATTTCAGG - Intergenic
971766106 4:30834103-30834125 AACATATAACACCATGTGCCAGG + Intronic
972631309 4:40844251-40844273 ACCATGTAACACAGTGTGCCTGG - Intronic
976697648 4:87935697-87935719 AAACTGTAACACTATGAGCCAGG - Intergenic
977090535 4:92669539-92669561 AACATGTAACAGTTGGTTTCAGG + Intronic
977125163 4:93156175-93156197 CTCATATAACACTGTGTTCCAGG - Intronic
977955138 4:103018057-103018079 CATATATTACACTATGTTCCAGG + Intronic
981218737 4:142205839-142205861 TACTTGTAACACTTTGTTTCTGG + Intronic
982057858 4:151570714-151570736 TATATGTCACACTCTGTTCCGGG - Intronic
982195460 4:152907837-152907859 AACATGTACAATTATGTTCATGG - Intronic
983094594 4:163546476-163546498 AATAGGTAACACTATCTTCTTGG + Intronic
983669413 4:170218093-170218115 TATATGTATCACTTTGTTCCTGG - Intergenic
987980048 5:25072659-25072681 AAAATGAACCACTATCTTCCAGG + Intergenic
988526576 5:31992474-31992496 AACATGCAAAACGATGTTCATGG - Intronic
989673639 5:43948745-43948767 AAGATGGAACACTATGTCCTTGG + Intergenic
991094627 5:62726633-62726655 CTCATCTAACACTATATTCCTGG - Intergenic
992886507 5:81165431-81165453 TAAATGTAACCCAATGTTCCAGG + Intronic
992950768 5:81855782-81855804 AACATGTAAAAACATGTTACAGG - Intergenic
993481566 5:88430766-88430788 AACATGTTGCACTGTGTGCCTGG - Intergenic
993489269 5:88526350-88526372 AATATTTAACAATATGTTCTGGG + Intergenic
1001658736 5:173374423-173374445 AACAAGCAAAACTTTGTTCCGGG + Intergenic
1002271641 5:178076259-178076281 AACATGCTAGACGATGTTCCAGG + Intergenic
1005124525 6:22431151-22431173 AACATGTAAAACTATCTACCAGG + Intergenic
1007748090 6:44055471-44055493 AACACATAGCACTATGTGCCAGG - Intergenic
1008500813 6:52180764-52180786 AACAATTAACAATTTGTTCCAGG + Intergenic
1009552046 6:65110029-65110051 AACATCTCAAACTATGTTCTTGG + Intronic
1010473509 6:76259344-76259366 CTTATGTAACACTATGTGCCAGG + Intergenic
1011042871 6:83050423-83050445 AACATGTTACATTAATTTCCTGG - Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1016695941 6:146996461-146996483 AAAATGTCCCACTATGATCCTGG + Intergenic
1017061042 6:150485255-150485277 AATATGTAACTTTCTGTTCCTGG + Intergenic
1017673052 6:156785461-156785483 AAAATGTAGCATTATGGTCCAGG - Intronic
1017986342 6:159446095-159446117 CACATGTCACATTGTGTTCCAGG - Intergenic
1021521785 7:21545916-21545938 AACTTGTAACACAATGCCCCAGG + Intronic
1028917929 7:96280234-96280256 AACATGTTTCACTATCTACCAGG - Intronic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1031714468 7:125090921-125090943 ACCATGTCACATGATGTTCCTGG + Intergenic
1032658279 7:133955181-133955203 AACATGTAACTCATTCTTCCTGG - Intronic
1033635508 7:143208313-143208335 AACCTGTCCTACTATGTTCCTGG + Intergenic
1034515530 7:151574949-151574971 AACATGTAATTCTTTGTTCCAGG - Exonic
1035654929 8:1298416-1298438 AACGTGTCACACTGTGATCCAGG - Intergenic
1036907101 8:12716149-12716171 AATATGGAAAACAATGTTCCAGG - Intergenic
1039338092 8:36616408-36616430 AATATTTAACATTCTGTTCCTGG - Intergenic
1042677774 8:71341305-71341327 ACCATGTAACGTTATGTTACGGG + Intronic
1046078087 8:109335886-109335908 AATATGTAACAATACGTTCTGGG + Intronic
1046829164 8:118725129-118725151 AACCTGAAACACTTTGTTCCTGG + Intergenic
1048127632 8:131654982-131655004 AACATGTGACACTTTGTGTCTGG - Intergenic
1048951933 8:139503659-139503681 ACAATGTCATACTATGTTCCTGG + Intergenic
1050864350 9:10479198-10479220 ATCATGTAACAGAATGTGCCTGG - Intronic
1051222327 9:14862732-14862754 AATATGTGACACTTTGTGCCTGG + Intronic
1051526240 9:18048055-18048077 AACATTTGACACTATGCTTCTGG + Intergenic
1052626051 9:30978624-30978646 AACATCTTACACTGTGTGCCTGG + Intergenic
1053580196 9:39395845-39395867 TATTTATAACACTATGTTCCTGG - Intergenic
1053844700 9:42223922-42223944 TATTTATAACACTATGTTCCTGG - Intergenic
1054101782 9:60954652-60954674 TATTTATAACACTATGTTCCTGG - Intergenic
1054123156 9:61230021-61230043 TATTTATAACACTATGTTCCTGG - Intergenic
1054584569 9:66952214-66952236 TATTTATAACACTATGTTCCTGG + Intergenic
1056547361 9:87623867-87623889 AGGAGGTAACACTTTGTTCCTGG + Intronic
1057900224 9:98942987-98943009 AAGATCTCACACTATGTGCCGGG + Intergenic
1058255633 9:102759294-102759316 AAAATGTAACATTCTGTTGCAGG - Intergenic
1059181789 9:112221925-112221947 AAGGGGTCACACTATGTTCCAGG + Exonic
1060751908 9:126175207-126175229 AACATGGAGCTCTATGTACCTGG - Intergenic
1061633397 9:131888855-131888877 GACCTGTAACACTGTGTTCTTGG - Intronic
1192346633 X:70314318-70314340 AACATGTAACAATATTCTGCCGG - Intronic
1193450669 X:81660973-81660995 AACATTTAACACTTTGTTGCTGG + Intergenic
1194897016 X:99455396-99455418 AACATGTTACCATATTTTCCAGG + Intergenic
1196155565 X:112424880-112424902 AAAATGTACCACTATGGTGCAGG - Intergenic
1196207727 X:112960127-112960149 TAAATGTACTACTATGTTCCAGG + Intergenic
1198018599 X:132636043-132636065 AACATGTATCACAATGTGCTGGG + Intronic
1198138735 X:133781515-133781537 AACTTGCAACACTATCTTCATGG + Intronic
1198953728 X:142103301-142103323 GCCATGTAACAATATATTCCAGG - Intergenic
1200797248 Y:7352285-7352307 CACAGGTACCACTATCTTCCAGG + Intergenic
1201306275 Y:12553344-12553366 AACATGAATCACAATGTTCGTGG - Intergenic