ID: 914391316

View in Genome Browser
Species Human (GRCh38)
Location 1:147225587-147225609
Sequence AAGCGAGCACAGACGGGGCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914391316_914391320 1 Left 914391316 1:147225587-147225609 CCTAGCCCCGTCTGTGCTCGCTT 0: 1
1: 0
2: 2
3: 8
4: 98
Right 914391320 1:147225611-147225633 TGCATCCACTTTTAACTTCCTGG 0: 1
1: 0
2: 4
3: 26
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914391316 Original CRISPR AAGCGAGCACAGACGGGGCT AGG (reversed) Exonic
900692980 1:3992857-3992879 AAGGGAGCACAGAAAGGGCCTGG - Intergenic
901613268 1:10516557-10516579 ATGCCAGCACAGACGAGGCTTGG - Intronic
904996871 1:34638215-34638237 AAGAGACCACTGACTGGGCTGGG - Intergenic
912568763 1:110607021-110607043 AAGAGTGCACAGAATGGGCTCGG - Intronic
914391316 1:147225587-147225609 AAGCGAGCACAGACGGGGCTAGG - Exonic
1063009778 10:2011161-2011183 GAGTGAGCACAGGTGGGGCTCGG + Intergenic
1065813761 10:29465640-29465662 AACTGACCACAGAGGGGGCTCGG + Exonic
1065957898 10:30709386-30709408 AACTGACCACAGAGGGGGCTCGG - Intergenic
1069709833 10:70481101-70481123 AGCAGAGCACAGACGGGGATGGG + Intronic
1069850167 10:71398913-71398935 GACCCAGCACAGACGGGGCCAGG - Intronic
1070463793 10:76697924-76697946 AAGAGAGCACACAGGGGGATTGG - Intergenic
1071873016 10:89815750-89815772 AAGAGAGCTAAGACAGGGCTGGG - Intergenic
1076526128 10:131113341-131113363 ACGCGTGCACAGAAAGGGCTAGG - Intronic
1076663374 10:132069908-132069930 ATGGGAGCACAGACGGGGCTCGG + Intergenic
1077039774 11:514845-514867 AAGTTAGCACAGGCGGGCCTGGG - Intergenic
1083171758 11:60927498-60927520 TGGGGAGCACAGCCGGGGCTGGG - Intronic
1083811229 11:65108063-65108085 AGCCGGGCACAGATGGGGCTCGG - Intronic
1084399859 11:68937243-68937265 AGGGGAGCCCAGACGGAGCTGGG - Intronic
1085032463 11:73281055-73281077 AATGGAGCACAAACAGGGCTTGG + Intronic
1088770041 11:113025589-113025611 AAGTGAGCAGAGAAGGGGGTGGG + Intronic
1092036360 12:5338595-5338617 AAGTGAGCAGAGCCTGGGCTTGG + Intergenic
1092251986 12:6904735-6904757 AAGCGAGAAGAGAGGGGGCGGGG - Intronic
1092777134 12:11953544-11953566 CAGCCAGCAGAGACGGGGCAGGG - Intergenic
1096717398 12:53499633-53499655 AGCCGAGCAGGGACGGGGCTAGG - Intronic
1096814263 12:54191758-54191780 AAGTGAGCAGAGTCGGAGCTAGG - Intergenic
1099661878 12:85574478-85574500 AAGCAAACACAGACAGGGCAGGG - Intergenic
1100874911 12:98951653-98951675 AAGAGGGCACAGACAGGGCTTGG - Intronic
1108422832 13:50267990-50268012 AAGGGAGCACAGGAGTGGCTAGG + Intronic
1113517554 13:110915062-110915084 GAGCGCGCACAGAGGGGGCGGGG + Exonic
1118850355 14:69578279-69578301 AAGCTAGTACAGGTGGGGCTGGG + Intergenic
1122182693 14:99967515-99967537 AAGCGTGGCCAGACGGGGCTGGG - Intergenic
1122465158 14:101928532-101928554 AAGGGAGCACAGACGCCACTGGG - Intergenic
1126981046 15:54243217-54243239 AAGTGAGAACATATGGGGCTTGG + Intronic
1129263559 15:74382211-74382233 GAGCGAGGCCAGAAGGGGCTGGG + Intergenic
1129612032 15:77068719-77068741 AAGTGAGAACACACGGTGCTTGG + Intronic
1129695744 15:77739804-77739826 AAGGGAGCACAGCGGTGGCTGGG + Intronic
1132956957 16:2599407-2599429 AGGCGAGTACAGACGGGGCCTGG + Exonic
1132969308 16:2677860-2677882 AAGCGAGTACAGACGGGGCCTGG + Intergenic
1132978990 16:2725262-2725284 AAAGGAACACAGACAGGGCTAGG - Intergenic
1133146299 16:3789209-3789231 GAGCGAGCACAGGTGGGTCTCGG + Intronic
1133169006 16:3969112-3969134 AAGGGAGCAGAGACTGGGCGCGG - Intronic
1133870706 16:9683105-9683127 AAGTGAGCACTGATGGGTCTAGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136226446 16:28863641-28863663 AAGCGACCACAGACGCAGCGGGG - Intronic
1136548113 16:30966555-30966577 AAGCAGGCACAGATGGGCCTGGG + Intronic
1139504214 16:67391085-67391107 CAGCGAGCACAGACATGGCTGGG - Exonic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1144246346 17:13369587-13369609 AAGTGAGAACATACGGTGCTTGG - Intergenic
1144835345 17:18153953-18153975 AAGCGAGCAGAGGAGGGTCTAGG + Intronic
1146652831 17:34616930-34616952 TGGCGAGCAGAGCCGGGGCTGGG + Intronic
1147736066 17:42639207-42639229 AAGGGAGCAGAGACTGGGCATGG + Intergenic
1152711302 17:81871531-81871553 AGGTGACCACTGACGGGGCTTGG - Intergenic
1152779430 17:82219701-82219723 AAGGGTGCAAAGAGGGGGCTGGG + Intergenic
1153652924 18:7257064-7257086 AAGGGAGCACATAGGAGGCTCGG - Intergenic
1160829602 19:1097383-1097405 AAGCCTGCACAGACCGGGCGGGG - Intergenic
1161706622 19:5825142-5825164 GAGAGAGGAGAGACGGGGCTGGG + Intronic
1165158746 19:33803638-33803660 AGCCAAGCACAGCCGGGGCTGGG + Intronic
1166288055 19:41844659-41844681 ACCCGTGCACAGACCGGGCTTGG + Exonic
1167454340 19:49590694-49590716 AAGATGGCACAGCCGGGGCTGGG - Exonic
926045648 2:9707896-9707918 AAGGCAGCACTGACGGGGGTGGG - Intergenic
926836878 2:17032774-17032796 AAGGGAGCACACAAAGGGCTTGG - Intergenic
929587814 2:43127180-43127202 CAGGGAGCCCAGACGGGGCGTGG - Intergenic
929675055 2:43918004-43918026 AGGCAAGCACATACGGGGATGGG - Exonic
932344636 2:70987611-70987633 AAGAGTGCACAGACGGGCCAGGG + Exonic
933696980 2:85226936-85226958 CAGCGAGAACAGTCAGGGCTTGG + Intronic
934743665 2:96744223-96744245 AAGGAAGGACAGGCGGGGCTCGG + Intergenic
945367260 2:208970226-208970248 AAGTGAGCCAAGACGGGGCTGGG + Intergenic
1171148379 20:22805330-22805352 AAGGCAGCACAGAAAGGGCTGGG + Intergenic
1172428931 20:34874691-34874713 AAGGGAGCACAGATGTTGCTGGG - Intronic
1172441378 20:34968866-34968888 AGGCCAGCACACAAGGGGCTGGG + Intergenic
1173001688 20:39109844-39109866 AAGCGAGCCTAGACGCTGCTGGG - Intergenic
1176010007 20:62888156-62888178 CAGCAAGCACTGAGGGGGCTAGG + Intronic
1176245719 20:64095527-64095549 AAGAGAGAACTGAAGGGGCTGGG + Intronic
1177171072 21:17656783-17656805 AAGCTAACACAGAGGGTGCTGGG - Intergenic
1179578208 21:42320956-42320978 ATGTGAGCACAGACGGGGCAGGG + Intergenic
1179631020 21:42678844-42678866 CAGGGTGCACAGACAGGGCTGGG + Intronic
1180197923 21:46208530-46208552 AAACCAGCCCAGACGGGACTGGG + Intronic
1182447291 22:30397230-30397252 CAGCGAGAAGGGACGGGGCTGGG + Intronic
1184587927 22:45460367-45460389 CAGCGAGCACAGGCTGGGTTGGG - Intergenic
1184692327 22:46122958-46122980 AAGCGAGAACAGAGGGAGGTGGG - Intergenic
1185346868 22:50314193-50314215 AGGGGAGCACAGACCTGGCTTGG + Exonic
951325426 3:21296967-21296989 AACCGTACACAGAAGGGGCTAGG - Intergenic
962630611 3:137272060-137272082 AAGAGAGCTCAGACGGCTCTGGG - Intergenic
967935877 3:194726997-194727019 AAAAGAGCACAGCCTGGGCTGGG - Intergenic
972325884 4:38014801-38014823 CAGCGAGCGCAGGCCGGGCTGGG - Exonic
976401393 4:84611000-84611022 AAGAGAGCAAAGACGGAGCTGGG + Intronic
989333035 5:40281962-40281984 AAGGGAGAAGAGATGGGGCTAGG - Intergenic
1003078732 6:3004110-3004132 AAGCGAACTCAGCTGGGGCTGGG - Intronic
1003084606 6:3051612-3051634 AAGCGAACTCAGCTGGGGCTGGG + Intergenic
1003673424 6:8181017-8181039 AAGCGAGCACAGAGCTGGCGAGG + Intergenic
1006627258 6:35406216-35406238 AAGATAGCACAGGCTGGGCTGGG - Intronic
1006844345 6:37051948-37051970 CAGCCAGCAGAGACAGGGCTGGG - Intergenic
1009420729 6:63461345-63461367 AAAAGAGCACAGACAAGGCTGGG - Intergenic
1010588892 6:77689566-77689588 AAGGGTGCACAGTCAGGGCTTGG + Intergenic
1012098330 6:94994981-94995003 AAGCGAGAACAGGCGGTGTTTGG - Intergenic
1017092934 6:150777958-150777980 ATGGGAGCACAGTCGGGGCCTGG - Intronic
1019637520 7:2083958-2083980 AAGCGGGCGCAGACTGGGCATGG + Intronic
1033628922 7:143138619-143138641 AGAGGAGCACAGATGGGGCTTGG + Intronic
1034437179 7:151068405-151068427 AAGCAAGCAAACACAGGGCTTGG - Intronic
1035846980 8:2875630-2875652 AAGTGAGCACAGAGAGGACTAGG - Intergenic
1045345787 8:101292308-101292330 AAGCGAGCACTGGGAGGGCTTGG + Intergenic
1050351041 9:4741358-4741380 GAGCGAGCGCAGAGGGGGCGCGG - Intronic
1052807504 9:33025671-33025693 GAGCGAGCACGGACGGGGAGGGG - Intronic
1053005541 9:34601932-34601954 AAGGAAGCAAAGACAGGGCTAGG + Intergenic
1057265228 9:93612998-93613020 AAGCGAGCACAGCTGGTGCCAGG + Intronic
1061370559 9:130195283-130195305 AAGGGGGCACAGGCTGGGCTTGG - Intronic
1062209064 9:135353416-135353438 AAGGGAAGACAGACGGGGCCAGG + Intergenic
1188242940 X:27810902-27810924 AAGTGAGGACTGATGGGGCTAGG + Intronic
1193511816 X:82411379-82411401 CAGTGGGCACAGACGTGGCTTGG - Intergenic