ID: 914393469

View in Genome Browser
Species Human (GRCh38)
Location 1:147242667-147242689
Sequence GCGCTTGGCCGCGCGGGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 268}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914393458_914393469 8 Left 914393458 1:147242636-147242658 CCCGCGCGTTGGGAAGTTGGGAG 0: 1
1: 0
2: 1
3: 22
4: 237
Right 914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 268
914393450_914393469 29 Left 914393450 1:147242615-147242637 CCCAGCGCGCAGTCGCGCGCCCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 268
914393459_914393469 7 Left 914393459 1:147242637-147242659 CCGCGCGTTGGGAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 268
914393457_914393469 9 Left 914393457 1:147242635-147242657 CCCCGCGCGTTGGGAAGTTGGGA 0: 1
1: 0
2: 0
3: 3
4: 89
Right 914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 268
914393451_914393469 28 Left 914393451 1:147242616-147242638 CCAGCGCGCAGTCGCGCGCCCCC 0: 1
1: 0
2: 0
3: 18
4: 157
Right 914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 268
914393455_914393469 10 Left 914393455 1:147242634-147242656 CCCCCGCGCGTTGGGAAGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 268
914393449_914393469 30 Left 914393449 1:147242614-147242636 CCCCAGCGCGCAGTCGCGCGCCC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 30
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914393469 Original CRISPR GCGCTTGGCCGCGCGGGGCG GGG Exonic
900126042 1:1069362-1069384 GGGCGTGGCCCTGCGGGGCGTGG + Intergenic
901004945 1:6167032-6167054 GCCCTTGGCAGCGCTGGGCCCGG - Intronic
901242818 1:7704795-7704817 GGGCTGGGCCGGGCCGGGCGGGG + Intronic
901242826 1:7704810-7704832 GGGCGGGGCCGGGCGGGGCGCGG + Intronic
901791286 1:11654815-11654837 GCGCTGCGCGGGGCGGGGCGCGG + Intronic
902586198 1:17439816-17439838 GGGCCAGGCCGGGCGGGGCGGGG - Intergenic
902771279 1:18646876-18646898 GCGCGGGGCGGCGCGGCGCGGGG + Intronic
903184747 1:21622611-21622633 GCGCGGGGCGGGGCGGGGCGGGG + Intronic
903597137 1:24503162-24503184 GCGCGGGGCGGGGCGGGGCGGGG + Intronic
904697038 1:32336450-32336472 GAGCTGGGCGGGGCGGGGCGGGG + Intergenic
904847438 1:33430821-33430843 GGGACGGGCCGCGCGGGGCGGGG - Intronic
905107742 1:35574201-35574223 GCGGGCGGCTGCGCGGGGCGCGG - Exonic
905174055 1:36125293-36125315 GCGCTGGGCCGGGCGGGGCGCGG - Intergenic
905449376 1:38046913-38046935 GCGGGCGGGCGCGCGGGGCGGGG - Intergenic
905580704 1:39081371-39081393 CCGCTAGGGCGCGGGGGGCGGGG + Intronic
906508040 1:46394447-46394469 GCGCCGGACGGCGCGGGGCGCGG + Exonic
909475222 1:76074639-76074661 GGGCGGGGCCGCGCGGGCCGCGG + Intergenic
912270125 1:108200212-108200234 GCGCGAGGCCGGGCTGGGCGGGG + Exonic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
915309347 1:154999582-154999604 GCGCTGGGGGGCGGGGGGCGTGG + Intergenic
917375554 1:174349031-174349053 GCGGCTGGCCGGGCGGGGGGGGG + Intronic
920029156 1:203026390-203026412 GCGCTTGGGGGCGGGAGGCGTGG + Intergenic
1062889693 10:1048954-1048976 GCGATTGGCTGCGCGGCCCGGGG - Exonic
1063443040 10:6089045-6089067 GCGCTCGGCGGCGCGGGGTCAGG - Intronic
1065520509 10:26567085-26567107 GCCCTTGGCCTTGAGGGGCGTGG - Exonic
1065687817 10:28303094-28303116 GCGGTTGGAGGGGCGGGGCGGGG + Intronic
1070152200 10:73811771-73811793 GCGCTTCCGCGGGCGGGGCGCGG - Intronic
1070752809 10:78973956-78973978 GGGCTGGGCCGGGCGGGGCCGGG - Intergenic
1072491177 10:95907565-95907587 GCGGTCGCCCGCGCAGGGCGTGG - Intronic
1073432084 10:103493615-103493637 GCTCTCGGCGGCGCGGGTCGGGG - Intergenic
1076156605 10:128210355-128210377 GCGCCTTCCCGGGCGGGGCGGGG + Intergenic
1077035836 11:494137-494159 GCGCTGGGCCGCGCTGGGCTGGG + Intergenic
1077103840 11:833434-833456 GCCATTGGCCGCGCCGGGCGGGG + Intronic
1077201649 11:1310255-1310277 GCGCCTGACCGCGAGGGCCGAGG - Intergenic
1077556376 11:3228002-3228024 GGGCTTGGCCGCGCAGTGCACGG + Exonic
1077575336 11:3378877-3378899 GCGCCGGGGCGCGCGGGGCCCGG + Intronic
1077916002 11:6611982-6612004 ACCCTTGGCGGCGCGGGCCGGGG - Exonic
1078334195 11:10450954-10450976 GCGCTGGGCAGAGCGGAGCGGGG - Exonic
1081672403 11:44949628-44949650 CCGCTGGGCGGGGCGGGGCGGGG - Intronic
1083033567 11:59615771-59615793 GCGGCTGGCCGGGCGGGGCGGGG - Exonic
1083669510 11:64292192-64292214 GCGCTTGGCGGCGCGTGCCGGGG + Intronic
1083758402 11:64803201-64803223 GCGCGGGGCGGCGCGGGGCGGGG + Exonic
1089216179 11:116836002-116836024 GCGCTTGGCCGCGCGCCTTGAGG - Exonic
1089556245 11:119317223-119317245 GGGCTGCGGCGCGCGGGGCGGGG - Intronic
1090385538 11:126355862-126355884 GCGCGGGGGCCCGCGGGGCGGGG + Intronic
1090768262 11:129895614-129895636 GGGCGGGGCAGCGCGGGGCGGGG + Intergenic
1094624065 12:32106619-32106641 GCGGTGGGGCGCGCGCGGCGGGG - Intergenic
1096178734 12:49539308-49539330 GCGCTAGGGAGCGCGGGGCCCGG + Exonic
1097127987 12:56789485-56789507 GCGGCTGGCCGGGCGGGGGGGGG + Intergenic
1097263316 12:57731827-57731849 GCGCTTGGCTGCCCGGTGCAGGG + Exonic
1101340751 12:103840639-103840661 GCTTTGGGCCGCGCGGGGCTGGG - Intronic
1103779354 12:123389006-123389028 GCCCCGGGCCGCCCGGGGCGAGG - Intronic
1103779428 12:123389194-123389216 GGGCCCGGCCGCGCGGGGGGCGG + Intronic
1104021189 12:124993620-124993642 GCGCCTTTGCGCGCGGGGCGGGG + Intergenic
1105217443 13:18297492-18297514 GCCCCGGGCCGCCCGGGGCGAGG - Intergenic
1105975454 13:25468743-25468765 GCCAGGGGCCGCGCGGGGCGTGG + Intronic
1113779720 13:112969172-112969194 GCGCTGCGCCGCGGGGGGCGGGG - Intronic
1114612635 14:24052533-24052555 GGGCTTGGCCCCGCCCGGCGGGG - Intronic
1115610655 14:35046228-35046250 GCGCGGGGCGGGGCGGGGCGGGG - Intronic
1116018365 14:39432578-39432600 GGGCTGGGCGGGGCGGGGCGGGG + Intergenic
1117377444 14:55129298-55129320 GCGGTGAGCTGCGCGGGGCGCGG + Exonic
1118019357 14:61695448-61695470 GCGCTCGGGCGCGCGGGGAGGGG - Intergenic
1118206498 14:63728101-63728123 GGGCTGGGCGGGGCGGGGCGCGG - Intergenic
1118836921 14:69484462-69484484 GGTGTTGGGCGCGCGGGGCGGGG + Intergenic
1119539329 14:75428278-75428300 GCGCCGGGACGGGCGGGGCGGGG + Intronic
1119808677 14:77498908-77498930 GCACGGGGCCGCGCGGGGCGGGG + Intergenic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1121226178 14:92323402-92323424 GGGCGCGGCGGCGCGGGGCGCGG + Intronic
1121253074 14:92513871-92513893 GCGCCGGGCCGCGCGGAACGCGG - Exonic
1121417402 14:93788723-93788745 GCGCCTAGCCGCGCGCGGGGCGG + Intergenic
1121711010 14:96039306-96039328 GCGCGGGGGCGGGCGGGGCGGGG - Exonic
1121911756 14:97798258-97798280 GTGCTAGGCAGCTCGGGGCGCGG - Intergenic
1122065895 14:99174470-99174492 GAGCTGGGCCGCCCGGGGCCCGG + Exonic
1122399575 14:101458790-101458812 AGTCTTGGCCGCCCGGGGCGCGG + Intergenic
1122779136 14:104136310-104136332 GGGCTCGGGGGCGCGGGGCGCGG + Intergenic
1122947795 14:105021082-105021104 GCGCCCGACGGCGCGGGGCGGGG + Exonic
1124629497 15:31328396-31328418 GCGCTTGGCGATGCGGGGGGCGG + Intronic
1124696753 15:31870328-31870350 GCGCGGGGACGCGGGGGGCGCGG - Intronic
1124696894 15:31870818-31870840 GCGCACGTCCGCGCGGGGCGGGG - Intergenic
1124712963 15:32030447-32030469 GCGCGGGGGCGGGCGGGGCGGGG + Intergenic
1125051198 15:35299560-35299582 GCGCTGGGCGGCGCGGGGTCAGG + Intronic
1125674259 15:41494088-41494110 CCGCTTGGCCCCGCGGGCCCGGG - Exonic
1126823671 15:52528931-52528953 GGGGAGGGCCGCGCGGGGCGGGG + Exonic
1126823678 15:52528941-52528963 GCGCGGGGCGGGGCGGGGCGGGG + Exonic
1127433431 15:58933790-58933812 GCGCTCGGTCGAGCGGGCCGCGG + Intronic
1127884739 15:63189454-63189476 CCGATTGGCCGCACGGGGCGGGG + Exonic
1128547785 15:68579330-68579352 GGGCTAGGCTGCGGGGGGCGCGG + Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132426815 15:101724561-101724583 GCGCTGGGCGGGGAGGGGCGGGG + Exonic
1132480661 16:164867-164889 GGGCTGGGCGGGGCGGGGCGCGG + Intronic
1132480702 16:164942-164964 GCGCGGGGCGGGGCGGGGCGGGG + Intronic
1132498861 16:275956-275978 GCGCGGCGCGGCGCGGGGCGGGG - Intronic
1132548889 16:546118-546140 GCGCTCAGCCCCGCGTGGCGAGG - Intronic
1132741338 16:1414768-1414790 GGGCGGGGCCGCGGGGGGCGTGG - Intergenic
1132778864 16:1612309-1612331 GTGCGCGGGCGCGCGGGGCGGGG - Exonic
1133220098 16:4316133-4316155 GCGCGAGGCCTCACGGGGCGCGG - Intronic
1134149711 16:11796621-11796643 GCCCTGGGCCGGGCGGGGAGAGG - Intronic
1134290780 16:12901798-12901820 GCGCCCGGCCGGGCGGGGGGAGG - Exonic
1134615718 16:15650075-15650097 CCGCTTGGCCGCGCCGCGCCCGG + Intronic
1135404746 16:22190183-22190205 GCGCGTAGCCGAGCTGGGCGCGG - Exonic
1136146708 16:28320620-28320642 GGGCTTGCGCGCGCGGTGCGAGG - Exonic
1136414696 16:30096098-30096120 TCGCCTGGGCGCGCGGGGCCCGG + Exonic
1136455646 16:30378352-30378374 GCGCTGGGCAGTGTGGGGCGCGG + Exonic
1136540216 16:30924364-30924386 GGGCCGGGCGGCGCGGGGCGCGG - Intronic
1139418086 16:66830712-66830734 GGGCCGGGCCGTGCGGGGCGCGG - Intronic
1141531225 16:84648442-84648464 GGGCCGGGCGGCGCGGGGCGGGG - Intergenic
1141533355 16:84661809-84661831 GCGCTTCGACGTGCTGGGCGTGG + Exonic
1142262230 16:89048425-89048447 GGGCTGGGACGCGCGGGGGGAGG - Intergenic
1143521542 17:7446972-7446994 GCGCGGGGCCTCGGGGGGCGGGG + Intronic
1144767006 17:17738379-17738401 GCGGCTGGCCTGGCGGGGCGGGG + Intronic
1145862985 17:28224288-28224310 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1145925280 17:28642359-28642381 GCACTTGGCCTTGCCGGGCGCGG + Intronic
1148167039 17:45490801-45490823 GCGATTGGCACCGCGGGCCGGGG - Intergenic
1148796886 17:50201340-50201362 GCGCTTGGTCCCGGGGGCCGCGG - Intronic
1150398217 17:64837206-64837228 GCGATTGGCACCGCGGGCCGGGG - Intergenic
1150747002 17:67824866-67824888 GGGCGTGGCAGCCCGGGGCGTGG + Intergenic
1150791667 17:68204896-68204918 GGGCGTGGCAGCCCGGGGCGTGG + Intergenic
1152251983 17:79217093-79217115 CAGCTTGGCCGTGCGGGGAGGGG - Intronic
1152584050 17:81181344-81181366 GCGGGGGGCCGCGCCGGGCGGGG - Intergenic
1153855126 18:9137291-9137313 GCGCTGCGCGGGGCGGGGCGGGG + Intronic
1154241601 18:12658117-12658139 GCGCGAGGCGGGGCGGGGCGGGG - Exonic
1154241607 18:12658127-12658149 GCGCTGGACGGCGCGAGGCGGGG - Exonic
1159586597 18:70288834-70288856 GCCGGGGGCCGCGCGGGGCGGGG - Intergenic
1160453066 18:78978906-78978928 GCGCCTGTGCGCGCGGGGCGAGG + Intergenic
1160869121 19:1269088-1269110 GCGCGCGGCGGGGCGGGGCGGGG - Intronic
1160966479 19:1749036-1749058 GGGCTTGGCGGCGAGGGGCGCGG - Intergenic
1160991984 19:1863782-1863804 GCGCGCGGCCGCCGGGGGCGGGG + Intergenic
1161027210 19:2042224-2042246 GTGTTTGGCCGGGTGGGGCGGGG - Intronic
1161293069 19:3506217-3506239 GCGATTAGCCGCGCGCGGCGTGG + Intergenic
1161613279 19:5255847-5255869 GCCCTAGGCCGGGCTGGGCGCGG + Intronic
1161851369 19:6739631-6739653 GGGCGGGGCCGGGCGGGGCGGGG + Intronic
1163158711 19:15452550-15452572 GGGCTTGGCCGTGCTAGGCGTGG + Intronic
1163462788 19:17448734-17448756 CCGCTGGGCCTGGCGGGGCGGGG + Intronic
1163527472 19:17830441-17830463 GAGATTGGCCACGAGGGGCGTGG + Intronic
1163807002 19:19405673-19405695 GCGCCCGGCTGGGCGGGGCGTGG - Intronic
1163807225 19:19406376-19406398 GCACGTGGGCGCGCGGGGCGGGG + Intronic
1164498699 19:28793661-28793683 GGGCTCGGCCGGGCGCGGCGGGG - Intergenic
1165305466 19:35000404-35000426 GGGCTGGGCTGCGCGGGGCTGGG - Exonic
1165349354 19:35267982-35268004 TTGTTCGGCCGCGCGGGGCGGGG + Intergenic
1166359092 19:42244861-42244883 GCGCCTAGCCGCGCGTGGTGCGG - Intronic
1166721819 19:45001453-45001475 GCCCGGGGCTGCGCGGGGCGCGG - Exonic
1166790391 19:45395692-45395714 GCGCGGGGCCCCGCGGGGCTGGG + Exonic
1168110543 19:54189411-54189433 GCGCGGGGGCGCGCTGGGCGGGG - Exonic
1168254037 19:55156483-55156505 GGGTTTGGCCGCTCGGGGCGTGG - Intronic
1168341353 19:55624683-55624705 GGGCGTGGCGGGGCGGGGCGTGG + Intergenic
926089984 2:10043498-10043520 GCGGCTGGCGGGGCGGGGCGCGG - Intronic
926310317 2:11670092-11670114 GAGCTGGGCCGCGGGGGCCGCGG + Exonic
927491738 2:23525620-23525642 GAGCTTGGCGGCGAGGGGCCTGG + Intronic
928904585 2:36356131-36356153 GCGCCTCCCCTCGCGGGGCGAGG - Exonic
929033663 2:37671682-37671704 GGGCGGGGCGGCGCGGGGCGGGG + Exonic
929218131 2:39437182-39437204 GCGGCGGGCCGCGGGGGGCGGGG - Exonic
929857931 2:45651558-45651580 GCCTCTGACCGCGCGGGGCGGGG - Intronic
933886216 2:86720820-86720842 CCGCGTGGGCGCGCGGGGCATGG + Intronic
933923964 2:87075886-87075908 CCGCGTGGGCGCGCGGGGCAGGG - Intergenic
934882500 2:97995954-97995976 GCGCTGGCCTGCGAGGGGCGGGG + Intergenic
937045653 2:118850032-118850054 GAGCCGGGCCGCGCGGCGCGCGG - Intergenic
940774940 2:157875872-157875894 GCGCGGGGCGGCGCGGGGCGGGG + Intergenic
942965778 2:181891670-181891692 GGCCGGGGCCGCGCGGGGCGCGG - Intergenic
943646015 2:190408464-190408486 GCGCTCAGCTGCGCGGGGCGCGG - Exonic
948207187 2:236168465-236168487 GCCATTGGCTGAGCGGGGCGGGG + Intergenic
948438186 2:237967616-237967638 GCGCTAGGCCGTGAGGAGCGGGG + Intronic
948479292 2:238240093-238240115 CCGATTGGCCGCGCGGGCCCGGG + Exonic
1168766071 20:382021-382043 GGGCCTGGCTGCGGGGGGCGGGG + Intronic
1168965091 20:1894254-1894276 GCGCGGGGGCGCGGGGGGCGGGG - Exonic
1169132437 20:3173192-3173214 GCGTGTGGCCCCGGGGGGCGGGG + Intronic
1169171747 20:3471022-3471044 TCGCCTGGCCGTGCGGGGCGGGG - Exonic
1170578767 20:17682510-17682532 GCGCTCGGCCGTGCGCGGGGCGG + Intergenic
1171173562 20:23035306-23035328 GCGGTGGGGCGCGCGGCGCGGGG + Intergenic
1171908894 20:30922446-30922468 GCTCTCGGCCGCGCGGTGCCTGG + Intergenic
1172320932 20:33994465-33994487 GCCCCTCGCCGGGCGGGGCGGGG - Intronic
1174504662 20:51009534-51009556 GCGCGTTTCCCCGCGGGGCGTGG + Intronic
1175800412 20:61798175-61798197 GGGCAGGGCCGGGCGGGGCGGGG - Intronic
1175907309 20:62387191-62387213 GGGCTTGGACGCGGGGGACGGGG + Intronic
1176135702 20:63521139-63521161 CGCCTTCGCCGCGCGGGGCGCGG - Intronic
1176550604 21:8219248-8219270 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1176569534 21:8402289-8402311 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1176577446 21:8446518-8446540 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1180182873 21:46125647-46125669 GCGGGGGGCCGGGCGGGGCGTGG + Intronic
1180950655 22:19719075-19719097 GCGCCTGGGCGCGCGGGCGGGGG + Intronic
1181064480 22:20299116-20299138 GCGGCTGGGAGCGCGGGGCGGGG + Intergenic
1181064525 22:20299266-20299288 GCGGCTGGGAGCGCGGGGCGCGG + Intergenic
1181283508 22:21736078-21736100 GGGCGGGGCCGCGCGGGGCGGGG + Intergenic
1181934496 22:26429222-26429244 GCGCTGGGCCGCCGGGGGAGGGG - Intergenic
1183093761 22:35540502-35540524 GCGCTGGGCGGCGGGAGGCGCGG + Intergenic
1183856064 22:40636194-40636216 GGGCTGTGCTGCGCGGGGCGGGG - Intronic
1203255503 22_KI270733v1_random:135591-135613 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1203256792 22_KI270733v1_random:143101-143123 GCTCTGGGCGGGGCGGGGCGAGG + Intergenic
949559257 3:5187567-5187589 GGGCCCGGCCTCGCGGGGCGCGG - Intergenic
950032695 3:9862888-9862910 GCGGTGAGCCGCGGGGGGCGGGG - Intergenic
950400942 3:12768879-12768901 GCCCATGGCGGGGCGGGGCGGGG + Intronic
953748629 3:45593814-45593836 GCCCCTGGCAGCGCTGGGCGGGG - Intronic
954249630 3:49358002-49358024 GCGCCGGGCGGAGCGGGGCGGGG - Intronic
955768638 3:62369298-62369320 TCGCTTACCCTCGCGGGGCGTGG + Intergenic
956675071 3:71725439-71725461 GCGCGGGGCGGGGCGGGGCGGGG - Intronic
956681448 3:71785252-71785274 GCGCGTGTGCGCGTGGGGCGTGG - Intergenic
956979034 3:74614823-74614845 GCGCAGGGCCGCGCGGGGTCCGG - Intergenic
961599884 3:128052392-128052414 GCGCGGCGCGGCGCGGGGCGGGG - Exonic
961657979 3:128453756-128453778 GTGCTGGGCAGCGCGGGGCTGGG - Intergenic
962245279 3:133785634-133785656 GCGGCTGGCCGGGCGGGGGGGGG - Intronic
964282231 3:155079651-155079673 GCGCCGAGACGCGCGGGGCGCGG + Exonic
965558138 3:170038079-170038101 GCGCGGGGCGGGGCGGGGCGGGG + Exonic
965615213 3:170585850-170585872 CCGCTGGGGCGCGGGGGGCGCGG + Intronic
966182012 3:177197020-177197042 GCGCTGGGCCGCGGGGGGATGGG - Intronic
967924137 3:194633219-194633241 GCGGCTGGGCGCGCGGCGCGGGG + Exonic
968092941 3:195909495-195909517 GCGCTGGGCCGAGCCGGTCGGGG - Intronic
968514868 4:1011760-1011782 GGGCTCGGGCGCTCGGGGCGCGG - Intronic
968879891 4:3293302-3293324 GCGCGGGGCGGGGCGGGGCGGGG + Intronic
969516413 4:7650716-7650738 GGGCTGGGCTGGGCGGGGCGGGG - Intronic
970585687 4:17512112-17512134 GGGGTTGGCCGGCCGGGGCGGGG - Exonic
973954419 4:56049075-56049097 GCGCCCGGCCCCGCGCGGCGTGG - Intergenic
976092421 4:81471972-81471994 GCGCCTGCCGGGGCGGGGCGGGG - Intronic
976719786 4:88158720-88158742 GCGCTCGGGCGCGCCGGGTGTGG - Exonic
977809701 4:101346063-101346085 GAGGGTGGCCGCGGGGGGCGCGG - Intronic
977848168 4:101790922-101790944 GCGCTGGGCCGCAGGGGGCGGGG - Exonic
980930059 4:139176695-139176717 GCGCCTGCCCGCGGGGAGCGCGG - Intronic
982257642 4:153466268-153466290 GCGCGGGGCGGGGCGGGGCGGGG + Intergenic
985595168 5:784707-784729 GCACTTGGTCGCGCGCGGCCGGG - Intergenic
985629949 5:1009027-1009049 GCGCGGGGCCCGGCGGGGCGTGG + Exonic
985784467 5:1886711-1886733 GCGCGGGCCGGCGCGGGGCGGGG - Intronic
986330770 5:6714481-6714503 GCGCGGGGCCGCGCGGCCCGGGG - Intergenic
987410981 5:17614860-17614882 GCGCTTGGAAGCGCAGGACGAGG + Intergenic
988073342 5:26323897-26323919 TTGCTTGGCCCCGCGGGGCTTGG + Intergenic
992939614 5:81750370-81750392 GAGCGGGGCCCCGCGGGGCGCGG - Intronic
997297548 5:132777334-132777356 GCTCGTGGCCGGGCCGGGCGGGG - Exonic
1002524526 5:179807572-179807594 GGGCTGGGCTGGGCGGGGCGAGG - Intronic
1003314950 6:5003789-5003811 GTGCTAGGCTTCGCGGGGCGGGG - Intronic
1003566892 6:7229805-7229827 CCGCGTGGCCGCGTGGGGCTGGG - Exonic
1003645481 6:7910435-7910457 GCGCTTGGGCGCCGCGGGCGGGG - Intronic
1004044395 6:12011627-12011649 CGGCTCGGCCGGGCGGGGCGGGG + Intronic
1006317070 6:33297533-33297555 GTCCTTGGCCGGGAGGGGCGGGG - Intronic
1006759000 6:36442969-36442991 CCGCGTGGCCGCGCGGTCCGGGG + Exonic
1013514768 6:110875492-110875514 GCGCTGGGCGGCGGGCGGCGCGG + Intronic
1014205543 6:118651670-118651692 GCGCGGCGCCGCGCGGGGCGGGG + Intronic
1015799364 6:137044777-137044799 GCGCTTGGCCCCAGCGGGCGTGG - Exonic
1016340909 6:143060800-143060822 GCGCGGGGCGGGGCGGGGCGGGG - Intronic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1019298303 7:290449-290471 GTTCTTGGCCTCGCGGGGAGGGG + Intergenic
1021389921 7:20079550-20079572 GTGCTGGGCGGCGCTGGGCGGGG + Intergenic
1022098585 7:27156085-27156107 GCGCTGGGGAGCGCGGAGCGCGG - Intronic
1022734425 7:33062813-33062835 GGGCGTCGCTGCGCGGGGCGGGG - Intergenic
1023638562 7:42237041-42237063 GCCCGCGGCCGCGCGGAGCGGGG - Intronic
1023888948 7:44379363-44379385 GCAGTTGGCGGGGCGGGGCGGGG + Exonic
1024043919 7:45574800-45574822 GCCCTTGGCCAGGCCGGGCGCGG - Exonic
1024499826 7:50093160-50093182 GCCCTTGGCCCAGCGCGGCGGGG - Exonic
1024579936 7:50793290-50793312 GCGCGGGTCCCCGCGGGGCGAGG + Intronic
1027248022 7:76380206-76380228 GCGGGGAGCCGCGCGGGGCGGGG - Intergenic
1029496328 7:100896999-100897021 GCGCGCGGCGGTGCGGGGCGCGG + Intergenic
1034228036 7:149497866-149497888 GGGCTGGGCGGGGCGGGGCGGGG - Intergenic
1034418665 7:150978006-150978028 CGGCTTGGCCGCGGGGTGCGGGG - Exonic
1034447962 7:151123041-151123063 GCGCTGGCCAGCGCCGGGCGTGG - Intronic
1034494119 7:151410003-151410025 GCGCTCGGCCGGGGAGGGCGCGG - Intronic
1036739432 8:11347597-11347619 GCGCCGGGCGGGGCGGGGCGGGG + Intergenic
1037769179 8:21789021-21789043 GCGGCTGGCGGCGCGGGGCGCGG + Intronic
1037825304 8:22156829-22156851 GCGCGGGGCGGCGCGGGGCCTGG + Exonic
1040032962 8:42842921-42842943 GCGCGTGTCCGCGCGAGGGGCGG - Intronic
1041673609 8:60516827-60516849 GCGCGGGGCGGGGCGGGGCGGGG + Intergenic
1047393735 8:124475056-124475078 GGGCAGGGCCGCGCGGGGCAGGG - Exonic
1048009302 8:130443425-130443447 GCGCTCGGGCGCGCTCGGCGGGG - Intronic
1049765784 8:144354590-144354612 GCGCGAGGCTGGGCGGGGCGGGG - Intronic
1049766662 8:144358272-144358294 GCGCGGGGCCGGGCGGGGCCGGG + Exonic
1049789365 8:144465868-144465890 GGGCGTGGCTGCGAGGGGCGGGG + Intergenic
1049896135 9:113529-113551 GCGCGGGGCGGCGCGGGGCCCGG + Intergenic
1051079546 9:13279186-13279208 GCGCCGGGCCGCGCGGGGTGGGG + Intronic
1051641812 9:19230731-19230753 GCGCTCGGCAGGGCAGGGCGGGG - Exonic
1053312023 9:37026348-37026370 GCACTTGGCCGCCCGGGCTGAGG - Intronic
1054891695 9:70258859-70258881 GCGCTCCGCCGCGCTGTGCGAGG - Intergenic
1054906611 9:70419033-70419055 GCGCTGGGCCGGTCGGAGCGCGG - Intergenic
1055530495 9:77178141-77178163 GGCTTTAGCCGCGCGGGGCGAGG + Intronic
1056787642 9:89604370-89604392 GCCCTTGGCCGAGCGCGGCGGGG - Intergenic
1056969809 9:91192656-91192678 GAGCTTGGCCTCGCTGGGCTGGG + Intergenic
1057313504 9:93955407-93955429 GCGCGGGGCGGGGCGGGGCGGGG - Intergenic
1057337547 9:94166989-94167011 GCACTTGGCCGCGGGGAGCAGGG - Intergenic
1057623309 9:96655343-96655365 GAGGTTGGGCGCGGGGGGCGGGG + Intergenic
1057995630 9:99820037-99820059 GCGCGGGGCGGGGCGGGGCGGGG - Intergenic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1058908530 9:109499844-109499866 GGGCCGGGCCGGGCGGGGCGCGG - Intergenic
1060408031 9:123382290-123382312 GAGCTTGGCCGGGCGGGGAATGG + Exonic
1060945776 9:127568785-127568807 GCCCCTGGGCGCGCGTGGCGCGG + Intronic
1061317090 9:129803158-129803180 CCGCTTGGCCGCGGGGCGCCTGG + Exonic
1061365936 9:130172508-130172530 GCGCCGGGGCGCCCGGGGCGTGG - Intergenic
1062467440 9:136687453-136687475 GGGCTGGGCGGGGCGGGGCGCGG + Intergenic
1062562061 9:137146148-137146170 GCGCTCGGCAGCGCGGGGCAGGG - Intronic
1203471899 Un_GL000220v1:118726-118748 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1203562683 Un_KI270744v1:71730-71752 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1185747465 X:2584186-2584208 GCGCGCGGGGGCGCGGGGCGCGG + Intergenic
1187163812 X:16786793-16786815 GGGTTTGGCGGCGCGCGGCGGGG + Intronic
1188242685 X:27809544-27809566 GCGGTGGGCGGGGCGGGGCGGGG - Intronic
1189137090 X:38561449-38561471 GGGCGGGGCGGCGCGGGGCGGGG - Exonic
1190680908 X:52826944-52826966 GCGGCTGGCCGGGCGGGGGGTGG + Intergenic
1190873888 X:54446230-54446252 GTGCTTGGCCGGGCGGGCCGAGG - Exonic
1192033994 X:67544456-67544478 GCGCTGGGCCGACGGGGGCGGGG - Intronic
1197800199 X:130340024-130340046 GCGCCAGGCCGCGCGGGGCCGGG + Intronic
1198158566 X:133985617-133985639 CCGCTTGGCGGCGCGGGGCAGGG + Exonic
1198871002 X:141177111-141177133 GCGCTTGGTGGCCAGGGGCGGGG + Exonic
1199846408 X:151695294-151695316 GCGCCCGGCTGCGAGGGGCGGGG + Intronic
1200098147 X:153673739-153673761 GCGCGGGGACGCGCGGGGCGGGG - Intronic
1200229442 X:154436849-154436871 GCGCGGGGCGGGGCGGGGCGGGG + Intergenic
1200239475 X:154486330-154486352 GCACCTGGCCGCGCGGAGGGTGG + Exonic
1201063772 Y:10070145-10070167 GCGCTGGGCTGCGCAGGCCGGGG + Intergenic
1201078061 Y:10201079-10201101 GCTCTTGGCTGCGCGGTGCCTGG + Intergenic