ID: 914395362

View in Genome Browser
Species Human (GRCh38)
Location 1:147261829-147261851
Sequence TATTGGGCTGAGATGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914395362 Original CRISPR TATTGGGCTGAGATGGGGAG GGG Intronic
901036136 1:6337327-6337349 TTAGGGGCTGAGAGGGGGAGAGG - Intronic
901501925 1:9657764-9657786 TGTTGGGCAGAGGTGGGGGGAGG + Intronic
901765221 1:11495710-11495732 TATTCCCCTGAGATGGGGAGAGG - Intronic
901911556 1:12462907-12462929 CATTGGGCTGAGATGAGGAGTGG - Intronic
902408510 1:16199528-16199550 TGTTGGCTTGAGCTGGGGAGGGG - Intronic
902525760 1:17056254-17056276 TATAGGTCAAAGATGGGGAGGGG - Intergenic
902942947 1:19813729-19813751 TAGCTGGCAGAGATGGGGAGGGG - Intergenic
903191835 1:21660929-21660951 AGTTGGGCTGAGCTGGGGACAGG + Intronic
903363330 1:22790776-22790798 TATTTAGCTTGGATGGGGAGAGG + Intronic
903551034 1:24157455-24157477 TATTTGGCTGAGAAGGGGCCAGG - Exonic
904237858 1:29125525-29125547 GAGTGGGATGAGAGGGGGAGAGG - Intergenic
904906001 1:33897708-33897730 AATTCACCTGAGATGGGGAGCGG + Intronic
905194050 1:36260349-36260371 TAAGGGGCTGGGAAGGGGAGTGG - Intronic
906542368 1:46597104-46597126 TATAGGGCTGGGGTGGGGAAGGG + Intronic
907391922 1:54163787-54163809 CATGGGGTGGAGATGGGGAGTGG + Intronic
908495705 1:64692363-64692385 TGTTTGACAGAGATGGGGAGGGG + Exonic
909818200 1:80024495-80024517 TATAGGGAGGAGATGGGGTGTGG - Intergenic
911932892 1:103927462-103927484 GATTGGGGTGAGGTGGGGTGAGG - Intergenic
913203644 1:116516341-116516363 TTTGGGGCTGAGATTGAGAGAGG - Intronic
914215456 1:145623688-145623710 TTTTGGGCTGAGAATGGGAAAGG - Exonic
914395362 1:147261829-147261851 TATTGGGCTGAGATGGGGAGGGG + Intronic
914467406 1:147944072-147944094 TTTTGGGCTGAGAATGGGAAAGG - Exonic
915137477 1:153743337-153743359 TCATGGGCTGAGATGGGAAGTGG + Intronic
915304714 1:154970682-154970704 TCTGGGTCTGAGCTGGGGAGCGG - Exonic
915701729 1:157802784-157802806 AATTTGGGTGAGGTGGGGAGGGG + Intronic
916780160 1:168018173-168018195 TAGTGGGCTCAAATGGGAAGGGG + Intronic
917361230 1:174178362-174178384 TTTTGGGCTGAGATGGGTGGTGG + Intronic
918409617 1:184245032-184245054 TACTTGGAAGAGATGGGGAGAGG + Intergenic
919591694 1:199511516-199511538 GATTGTTATGAGATGGGGAGAGG - Intergenic
919621206 1:199866306-199866328 TCTTGGGGTGGGATGGGGCGGGG - Intergenic
920552376 1:206873375-206873397 TACTGTGCTGAGATGGGGTAGGG - Intergenic
921095980 1:211887661-211887683 TCTGGGGCTGAGATGGGGCATGG - Intergenic
922084857 1:222336621-222336643 CTATGGGCTGAGAAGGGGAGGGG + Intergenic
923410699 1:233706427-233706449 TAGTGGGATGAGATGAGGGGAGG - Intergenic
1063266679 10:4459056-4459078 GATGGGGCTGAGATGAGAAGGGG - Intergenic
1064315708 10:14254108-14254130 TGGAGGGCTGAGGTGGGGAGGGG - Intronic
1067752129 10:48978451-48978473 CCTTGGGCTGAGGTGGAGAGAGG - Intronic
1070309297 10:75261748-75261770 TATGGAGCTGAGATGGAGGGAGG - Intergenic
1070641078 10:78170606-78170628 GATTGGGCACAGAAGGGGAGGGG + Intergenic
1070673697 10:78397303-78397325 AAGGGAGCTGAGATGGGGAGAGG + Intergenic
1072453806 10:95559784-95559806 GTTTGGGCTGTGAGGGGGAGGGG - Intronic
1073501990 10:103948114-103948136 GGTGGGGGTGAGATGGGGAGAGG + Intergenic
1074264422 10:111887393-111887415 TATTGTGCTTAGATGAGCAGAGG + Intergenic
1076142048 10:128086984-128087006 CAATGGATTGAGATGGGGAGAGG - Intergenic
1076643942 10:131938516-131938538 TAGCAGGCTGAAATGGGGAGGGG - Intronic
1076798727 10:132811061-132811083 CCTTGGCCTGACATGGGGAGTGG + Intronic
1078738445 11:14043583-14043605 CATTGGGCTGTCATGGGTAGTGG - Intronic
1078852103 11:15173402-15173424 TAGTTGGCTGAGATTGGAAGGGG + Intronic
1079290148 11:19180757-19180779 TAGTGGGTAGAGATGGGGGGAGG + Intergenic
1079999987 11:27336067-27336089 GTATGGGCTGAGATGGGGAGAGG - Intronic
1084459823 11:69290432-69290454 TATTGGGCTGGGGTGGGGCATGG + Intergenic
1085911178 11:80828804-80828826 GTTTGGGCTGGGATTGGGAGGGG - Intergenic
1087592155 11:100203762-100203784 TAATTGGATGGGATGGGGAGGGG - Intronic
1088537526 11:110877279-110877301 GCGTGGACTGAGATGGGGAGAGG - Intergenic
1088548904 11:110990747-110990769 TATTTGGCTGGGAGGGGGAGTGG - Intergenic
1089175186 11:116543567-116543589 TGATGGGGTGAGATGGGGAAGGG + Intergenic
1089587429 11:119519434-119519456 TGGTGGGCTGGGATGGGGATGGG - Intergenic
1090057656 11:123437485-123437507 TACTGGGCAGAGATGCAGAGAGG - Intergenic
1090642306 11:128740071-128740093 TATGGGGCAGAGATGTGGGGTGG - Intronic
1091628932 12:2143893-2143915 TGTTGGGGTGAGGTGGAGAGAGG - Intronic
1091663408 12:2401016-2401038 TTCTAGGCCGAGATGGGGAGGGG - Intronic
1092495101 12:8985861-8985883 TACTGGGGTGACAAGGGGAGGGG - Intronic
1093702937 12:22243261-22243283 TGTTGGGCAGAGATGTGCAGTGG - Intronic
1095161475 12:38922259-38922281 TGTTGGGCGGGGGTGGGGAGGGG - Intergenic
1096134687 12:49189322-49189344 TATGGGGCGGGGTTGGGGAGGGG + Exonic
1096240577 12:49957848-49957870 TGTTGGGGTGAGGTGGGGTGGGG - Exonic
1096615403 12:52830165-52830187 TACTGGGCTGATTCGGGGAGAGG - Intronic
1097054256 12:56240456-56240478 TTTAGGGCTGCGGTGGGGAGAGG + Exonic
1097381469 12:58900134-58900156 TACTGGGCTGAGTTTTGGAGGGG + Intronic
1098822557 12:75251310-75251332 TATAGGGCTGAGATGAAGAAAGG - Intergenic
1099933047 12:89095567-89095589 TATAGGGTTGGCATGGGGAGAGG - Intergenic
1100569720 12:95836698-95836720 AAGTGAGATGAGATGGGGAGAGG - Intergenic
1101742339 12:107510368-107510390 TATAAGGCTGTGCTGGGGAGGGG - Intronic
1101786329 12:107886760-107886782 AAATGAGCTGAGATGTGGAGTGG - Intergenic
1102241299 12:111326127-111326149 TATAGTGTTGTGATGGGGAGGGG + Intronic
1103063538 12:117878035-117878057 TGAGGGGCTGAGATGTGGAGAGG + Intronic
1103921712 12:124402719-124402741 CACTGGCATGAGATGGGGAGAGG + Intronic
1104008720 12:124914282-124914304 TATTCGGGTGAGATGGGCTGGGG - Exonic
1105345221 13:19565084-19565106 TTTTGGCCTGAGTTGGGGAGCGG - Intergenic
1106254431 13:28009902-28009924 TATGGGGCTGAGTAGGAGAGGGG + Intronic
1107459711 13:40590067-40590089 TATTGGGAGGAGTTGGGTAGGGG - Intronic
1112604289 13:100888847-100888869 TATAGGTCTGAGGTGGGAAGTGG + Intergenic
1113056767 13:106276712-106276734 TTCTGGGTTGAGATGGGGGGTGG - Intergenic
1114300701 14:21374498-21374520 TCTAGGGCTGAGATGGAGATAGG - Intronic
1114616508 14:24071512-24071534 TATGGGGCCTGGATGGGGAGGGG - Exonic
1114636317 14:24188808-24188830 TACTGGGCCGAAAAGGGGAGGGG + Exonic
1115305290 14:31927690-31927712 ACTAGGGCAGAGATGGGGAGGGG - Intergenic
1115641603 14:35338915-35338937 GATTGGGCTGGGCGGGGGAGGGG + Intergenic
1118867090 14:69712280-69712302 TAATGGCCTGAGGTGGGCAGAGG + Exonic
1119682011 14:76599537-76599559 TATGGGGCCGATAGGGGGAGAGG - Intergenic
1121176057 14:91891542-91891564 TATGGGACTGAGATGGGTCGAGG - Intronic
1122211141 14:100174933-100174955 TAGTGAGCAGAGTTGGGGAGAGG - Intergenic
1123113304 14:105882797-105882819 TCATGGGCTGACCTGGGGAGTGG + Intergenic
1123439878 15:20282501-20282523 TGATGGGCAGAGGTGGGGAGGGG + Intergenic
1123485344 15:20730788-20730810 ATTTGGGTTGAGTTGGGGAGCGG + Intergenic
1123541832 15:21299837-21299859 ATTTGGGTTGAGTTGGGGAGCGG + Intergenic
1124560970 15:30773038-30773060 GGGTGGGCTGAGGTGGGGAGGGG - Intergenic
1124669557 15:31626016-31626038 GGGTGGGCTGAGGTGGGGAGGGG + Intronic
1125514484 15:40310125-40310147 TCCTGGGCTGAGCTGGGTAGAGG + Intergenic
1125701563 15:41690098-41690120 GATTGGGTGGAGCTGGGGAGTGG - Intronic
1126108590 15:45162729-45162751 TATTGGGCTGGGAGAGGGAAGGG + Intronic
1126160874 15:45612277-45612299 TTTTTGGCAGAGATGGGGGGGGG - Intronic
1127690413 15:61390397-61390419 TTTTGAGGTGAGATGGTGAGTGG - Intergenic
1128196036 15:65757249-65757271 TATTCTTCTGAGATGGGGGGGGG + Intronic
1130941092 15:88509869-88509891 TCTTGGATTGAGATAGGGAGAGG - Intergenic
1131661884 15:94526093-94526115 GAGAGGGCTGAGATGGGGAGAGG - Intergenic
1202950147 15_KI270727v1_random:26979-27001 ATTTGGGTTGAGTTGGGGAGCGG + Intergenic
1134427553 16:14165649-14165671 TGTAGGGATGAGATGGGGAAAGG - Intronic
1134610075 16:15601133-15601155 TGCTTGGCTGAGATGGAGAGCGG - Intronic
1134782840 16:16914430-16914452 GCTTGGGCTAAGATGGGGAGAGG + Intergenic
1135698169 16:24608853-24608875 TATTGGGCAGAATAGGGGAGTGG + Intergenic
1135736089 16:24932791-24932813 TTTTGGGCTGGGAGGGGTAGGGG + Intronic
1136073898 16:27805092-27805114 TGTGGGGCTGAGATTGGGGGTGG + Intronic
1136232493 16:28894806-28894828 CTTTGGCCTGAGATGGGCAGAGG - Exonic
1136845291 16:33571896-33571918 TGTTGGGCAGAGCAGGGGAGGGG - Intergenic
1138111938 16:54330786-54330808 TACCCTGCTGAGATGGGGAGAGG + Intergenic
1138821999 16:60271885-60271907 TTTTGTGTTCAGATGGGGAGGGG - Intergenic
1141335973 16:83155703-83155725 GATGGGGGTGAGATGAGGAGAGG + Intronic
1203106999 16_KI270728v1_random:1420549-1420571 TGTTGGGCAGAGCAGGGGAGGGG - Intergenic
1203155459 16_KI270728v1_random:1872194-1872216 TGTTGGGCAGAGCAGGGGAGGGG - Intergenic
1142813945 17:2410924-2410946 TATCGGGCTGGACTGGGGAGAGG + Intronic
1142831993 17:2556023-2556045 TATTGGGCTGAGTTGGCCTGAGG + Intergenic
1143112411 17:4559910-4559932 TCTTGGGCAGACATGGGGATGGG + Intronic
1143175914 17:4955059-4955081 TGAAGGCCTGAGATGGGGAGAGG - Exonic
1143188328 17:5023807-5023829 TCTTGGCCAGGGATGGGGAGCGG + Exonic
1143576854 17:7798830-7798852 TACAGGGCTGAGGTGGGCAGTGG - Intronic
1145909263 17:28533205-28533227 CTTTGGGCTGAAAGGGGGAGGGG + Intronic
1146042450 17:29469217-29469239 TTTTTGACTGAGATGGGGCGGGG - Intronic
1146929537 17:36767807-36767829 TTTCAGGCTGAGGTGGGGAGGGG + Intergenic
1147308525 17:39579829-39579851 TCTTGGGCTGGCTTGGGGAGGGG - Intergenic
1148552241 17:48557459-48557481 CTTTGGGATGAGATAGGGAGTGG + Intronic
1148806333 17:50265790-50265812 TGATGGGCTGTGATGGGGAAAGG - Intergenic
1149002237 17:51769483-51769505 TATTTGGGGGTGATGGGGAGTGG + Intronic
1150307396 17:64097640-64097662 TATTGGGTTGTTATGGTGAGGGG - Intronic
1150503203 17:65671096-65671118 TGTTTGGCTGAGAAGGGGGGTGG + Intronic
1150693771 17:67386556-67386578 TGTAGGTATGAGATGGGGAGTGG + Intronic
1150810394 17:68351918-68351940 TATTGAGCTCAGCTAGGGAGAGG + Intronic
1151589976 17:75036845-75036867 GACTGGGCAGAGATGAGGAGCGG - Intronic
1152011206 17:77719387-77719409 TCTTGGTCAGAGGTGGGGAGGGG + Intergenic
1152106783 17:78334839-78334861 CCTTGGCCTGAGATGAGGAGAGG - Intergenic
1152520286 17:80852293-80852315 TATTGGGCAGAGATGGAGGCAGG + Intronic
1153306156 18:3632930-3632952 TTTTGAGTTGAGATGGGGAGTGG + Intronic
1153770933 18:8416043-8416065 TATGGGGAGGAGATGGAGAGAGG - Intergenic
1155300880 18:24427451-24427473 TGTTGGGGGGAGGTGGGGAGGGG - Intronic
1155414928 18:25587467-25587489 TAGTGGGGTGAGGAGGGGAGGGG + Intergenic
1155980861 18:32177939-32177961 TGATGGGCTGAGAGGGAGAGAGG - Intronic
1156293980 18:35773603-35773625 TAATGGGCTGAGTTGGGATGTGG + Intergenic
1156415763 18:36887864-36887886 AATTGGGATGAGTTGGGGAAAGG + Intronic
1157192201 18:45591039-45591061 TGTTGGGGTGGGATTGGGAGTGG - Intronic
1157299046 18:46466576-46466598 TATTGGGGTGAGATAGGTTGAGG + Intergenic
1157537907 18:48474077-48474099 CAGTGGGCTGGGATGGGGGGTGG + Intergenic
1158404977 18:57152850-57152872 CCATGGGCTGAGATGGGAAGGGG + Intergenic
1158452303 18:57578186-57578208 CATATGGCTGAGGTGGGGAGAGG + Intronic
1161411959 19:4122312-4122334 TATGGGGGAGAGATGGGGTGAGG - Intronic
1161411972 19:4122342-4122364 TATGGGGGAGAGATGGGGTGAGG - Intronic
1161411998 19:4122402-4122424 TATGGGGGAGAGATGGGGTGAGG - Intronic
1161474501 19:4476805-4476827 TTCTGGGGTGAGGTGGGGAGTGG + Intronic
1163202752 19:15780265-15780287 TCCTGGCCTGGGATGGGGAGGGG - Intergenic
1163222917 19:15934751-15934773 TCCTGGCCTGGGATGGGGAGGGG - Exonic
1163716395 19:18874817-18874839 CAATGGGGTGAGATGGGGTGAGG + Intronic
1165108059 19:33486222-33486244 GTGGGGGCTGAGATGGGGAGGGG - Intronic
1165243367 19:34483723-34483745 TCTTGGGGTGAGATTGTGAGCGG + Intronic
1165490295 19:36119493-36119515 CCTCTGGCTGAGATGGGGAGCGG - Intronic
1166193826 19:41193608-41193630 TCCAGGGCTGAGAAGGGGAGAGG + Intronic
1166699093 19:44871842-44871864 TCTTGGGCTTGGCTGGGGAGAGG - Exonic
1167351853 19:48980227-48980249 TATTGGGCAGAGACGAGGAAAGG - Intronic
1167455112 19:49593716-49593738 AATTGGGGTGGGTTGGGGAGAGG - Intronic
1167560088 19:50221803-50221825 GATAGGGCAGAGATGGCGAGTGG - Intronic
1168245508 19:55111494-55111516 TCTTTGGTTGAAATGGGGAGTGG - Intronic
1168669706 19:58231195-58231217 CATTGGGCTGGGCTGGGGTGGGG + Intronic
925620450 2:5787175-5787197 CATTGGGCTGAGCTGGGGCGGGG + Intergenic
926480764 2:13390874-13390896 TAATGGGCTGAAATGAAGAGAGG - Intergenic
926692657 2:15748087-15748109 CAGGGGGCTGAGGTGGGGAGGGG - Intergenic
927904386 2:26846902-26846924 GATTTTGCTGAGATGGGGAGAGG + Intergenic
928597758 2:32872337-32872359 TAGAGGGGAGAGATGGGGAGGGG + Intergenic
929031617 2:37654530-37654552 GAATGGGCTGGGGTGGGGAGGGG + Intronic
929037146 2:37705101-37705123 AATGGGCCTGAGATTGGGAGAGG - Intronic
930308977 2:49714125-49714147 TCTTGGGCTTATATGGGGATAGG - Intergenic
930479326 2:51926806-51926828 TCTTGGGCAGAGATGGGGGCTGG - Intergenic
930701940 2:54467213-54467235 TCTTGGGCTGGGATAGGGATAGG + Intronic
932508634 2:72262534-72262556 TATTGGTCTGAGTTGTGGTGGGG + Intronic
933164512 2:79061386-79061408 AATGGGACTGAGCTGGGGAGGGG - Intergenic
933727488 2:85435027-85435049 TATTGAGCTGGGGTGGGGTGGGG - Exonic
934501274 2:94861930-94861952 TCTTGGCCTCCGATGGGGAGTGG + Intergenic
934606681 2:95700501-95700523 TAGTGGGCTGAGTGTGGGAGCGG + Intergenic
934679025 2:96269370-96269392 TATGGGGATGGGATGGGGTGGGG - Intronic
934696843 2:96406138-96406160 GATTGGGCTGAGCTGGAGATGGG - Intergenic
935306013 2:101737195-101737217 TGTTGGTCAGAGATGGTGAGTGG + Intronic
935492528 2:103737669-103737691 TAAGGGGGTGAGATGGGGTGTGG + Intergenic
936523534 2:113227395-113227417 ACTTGGGCTCAGATGAGGAGTGG - Intronic
937487068 2:122326316-122326338 TATGGGGCTGAAGAGGGGAGAGG + Intergenic
937682317 2:124657279-124657301 TATTTGGCAGAAATGGGGAGAGG - Intronic
937930975 2:127205050-127205072 TCTTCGGCTGAGATGGAGAGAGG - Intronic
938805216 2:134800850-134800872 CATTGGTCTGAGATGGGAAGAGG + Intergenic
940688827 2:156888295-156888317 TATTTGGCAGGGATGGGGTGGGG + Intergenic
941470894 2:165885538-165885560 AGGTGGGCTGAGGTGGGGAGAGG - Intronic
942301172 2:174563928-174563950 TATTTGGTTGGGATGGTGAGAGG - Intronic
942455357 2:176134673-176134695 TATTTGGGTAAGATGGGGAGAGG + Intergenic
944535538 2:200705894-200705916 GTTTGGGGTGAGATGTGGAGGGG - Intergenic
944809314 2:203312306-203312328 TAGTGAGCAGAGCTGGGGAGAGG + Intergenic
945723923 2:213451936-213451958 GAGTGGGGTGAGATGGGGTGGGG - Intronic
946324968 2:218980577-218980599 TATTGGGATAAGATGGGGTGAGG + Intergenic
948661435 2:239508936-239508958 TCCTGGGCTGAGGTGGGCAGGGG + Intergenic
1168979386 20:1991875-1991897 TCTTCTGCTGGGATGGGGAGGGG + Intronic
1169953035 20:11068391-11068413 TCTGGGGCTGAGATGGGGATTGG + Intergenic
1169997959 20:11579804-11579826 CATTGGGTTGGGATGGGGAGTGG + Intergenic
1172005080 20:31813746-31813768 AATTGGTCTGAGCTGAGGAGGGG + Intergenic
1173138976 20:40465444-40465466 CATTGGCCTGGGATGGGGAGGGG - Intergenic
1173153440 20:40587293-40587315 TCTTGGGCTGAGATGGGGAAGGG - Intergenic
1173421169 20:42902387-42902409 AATGGAGCTGAGATGTGGAGTGG - Intronic
1173753655 20:45496329-45496351 TCTTGGGCAGGGAAGGGGAGAGG + Intergenic
1174163485 20:48568151-48568173 TAGGGGGCTTAGATGGGGAAGGG + Intergenic
1174522371 20:51141588-51141610 TTTTGGGTTGGGTTGGGGAGGGG + Intergenic
1176195753 20:63835800-63835822 TAATGGGATGGGATGGGGCGGGG + Intergenic
1177038248 21:16072029-16072051 CATTGTGCTGGGATGGGAAGGGG - Intergenic
1177425051 21:20911913-20911935 CATTTGGCAGAGATGGTGAGGGG + Intergenic
1177685974 21:24438026-24438048 TTTTGGGGGGGGATGGGGAGGGG - Intergenic
1179038310 21:37779397-37779419 TATAGCAATGAGATGGGGAGAGG + Intronic
1179162714 21:38911168-38911190 AATTGTGCTTAGATGGGGTGGGG - Intergenic
1179297690 21:40078320-40078342 GATTGGGATGAGGTGGGGAAAGG + Intronic
1179376769 21:40856435-40856457 GATTGGGTTGAGGTGGAGAGAGG + Intergenic
1179594500 21:42433373-42433395 AAGTGAGCTGAGCTGGGGAGAGG - Intronic
1181673228 22:24435776-24435798 AGTTGGGATGAGATGGGTAGAGG - Intronic
1181976691 22:26735990-26736012 TGGTGGGATGGGATGGGGAGGGG - Intergenic
1182793843 22:32976175-32976197 TATTGGGTTGGGATGGGGTTAGG - Intronic
1183361328 22:37384734-37384756 AATTGGGGTCAGGTGGGGAGAGG - Intronic
1183462073 22:37957423-37957445 TATGGGGCTGAGAAAGTGAGTGG + Intronic
1183607390 22:38873624-38873646 CTTGGGGCTGAGATGGGGTGGGG + Intergenic
1183830468 22:40416127-40416149 TGATGGGGTGAGCTGGGGAGGGG - Intronic
1183948142 22:41338420-41338442 TACAGGGCTGGGATGGGGAGGGG - Intronic
1184411127 22:44327134-44327156 TGCTGTGCTGTGATGGGGAGAGG - Intergenic
1184414970 22:44346940-44346962 GAATGGGCTGAGATGGGGGCTGG - Intergenic
1184636550 22:45836624-45836646 CACTGGGGTGAGATGGGGTGAGG + Intronic
1184892095 22:47386331-47386353 TTTTGGGCTGGGATGTGGCGTGG + Intergenic
1184892325 22:47387589-47387611 TTTTGGGCTGGGATGTGGCGTGG + Intergenic
1185011905 22:48319260-48319282 TATTGGGCTGGGTTGGGCTGCGG - Intergenic
1185374780 22:50477356-50477378 TGATGGCCTGAGATGAGGAGTGG - Intergenic
950084886 3:10249898-10249920 TATTGGGCTGAGGTGTGGTCTGG + Intronic
950698930 3:14726744-14726766 CACTGGGCTGAGAGGGAGAGAGG + Intronic
950978886 3:17280436-17280458 TATTGGCATGGGATGAGGAGTGG - Intronic
951278809 3:20721811-20721833 TACTGGGTTGAGCAGGGGAGGGG + Intergenic
951364800 3:21768556-21768578 CATAGGGCTGTGTTGGGGAGGGG - Intronic
951425892 3:22544728-22544750 TATTGGGTTGATATGGGGGAGGG - Intergenic
952084678 3:29803421-29803443 TATTATGCTGTGATGGGGATGGG - Intronic
954032746 3:47831419-47831441 TTTTGGCATGAGATGTGGAGGGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958056585 3:88420067-88420089 TATTGGTCTGAGATAGGGCTTGG + Intergenic
958178870 3:90031633-90031655 TGGTGGGCTGAAATGGGCAGTGG - Intergenic
958265876 3:91436270-91436292 AATTAGGCTGAGAGGGGAAGTGG - Intergenic
961108210 3:124260379-124260401 TGTAGGGCTGAGCTAGGGAGTGG - Intronic
961644870 3:128387589-128387611 TTCTGGGCTGAGCTGAGGAGAGG - Intronic
962953247 3:140240924-140240946 TAAGAGGCTGAGGTGGGGAGTGG + Intronic
964588260 3:158331161-158331183 TGTTGGGCTCAGAGGGTGAGGGG + Intronic
966366794 3:179196954-179196976 GATTGGTGTGAGATGGAGAGAGG + Intronic
966891892 3:184413267-184413289 AATTGGGGTGAGTGGGGGAGGGG - Intronic
967695785 3:192528945-192528967 TCTAGGCCTGAGATGGGAAGGGG + Intronic
967787069 3:193508695-193508717 AATGGGACTGAGTTGGGGAGTGG + Intronic
967887519 3:194343169-194343191 GAGTGGGCAGAGATGGGCAGAGG - Intronic
967927644 3:194663848-194663870 TCTTGGGCTGGGATGCGGGGAGG - Intronic
967938482 3:194748122-194748144 TATTGAGCTGAGAGAGGGAAGGG + Intergenic
970365144 4:15350512-15350534 TAGTGGCCAGAGATGGAGAGAGG - Intronic
971810268 4:31416332-31416354 CAGTGGGCTGAGATGGAGGGTGG + Intergenic
972738394 4:41866915-41866937 TTATGGGCTGGGATGTGGAGCGG - Intergenic
973605991 4:52588353-52588375 CATAGGGCTGGGGTGGGGAGGGG - Intergenic
973855811 4:55008964-55008986 GAATGGGCTGGAATGGGGAGAGG - Intergenic
977265401 4:94847794-94847816 TAGTGGGGTGGGATTGGGAGTGG + Intronic
977559463 4:98517626-98517648 TAGTCATCTGAGATGGGGAGGGG + Intronic
978558527 4:110006920-110006942 TTCTGGGCTGAGGTGGGGAAAGG - Intronic
979313699 4:119234379-119234401 TATAGGGTTGAGATGGAGGGAGG + Intronic
979459007 4:120959009-120959031 TAGTGGTCTGGGATGGGGAGAGG - Intergenic
981206914 4:142053112-142053134 TATTAGGCAGAGAAGGGGAAAGG + Intronic
981717140 4:147762854-147762876 AAGTGGACTGTGATGGGGAGTGG + Intronic
981960989 4:150538634-150538656 TAAAGGGGGGAGATGGGGAGGGG + Intronic
985526184 5:403194-403216 TACCGGGCTGAGGAGGGGAGTGG + Intronic
985856902 5:2435354-2435376 AATTGAGCTGAGAATGGGAGGGG - Intergenic
986707878 5:10466329-10466351 TGTTGGGAGGTGATGGGGAGGGG + Intronic
987016665 5:13827358-13827380 TCTGGGCCTGTGATGGGGAGGGG - Intronic
989004008 5:36789583-36789605 GATTTGGCAGAGGTGGGGAGGGG + Intergenic
989181937 5:38587162-38587184 TAGAGGGCTGGGGTGGGGAGGGG - Intronic
991601104 5:68351918-68351940 TATAAGGCTGTGATGGGGATTGG - Intergenic
992428555 5:76684641-76684663 TATTGGGGTGAGATGGAGACTGG + Intronic
993817658 5:92572237-92572259 CAGTGGGGTGAGATGAGGAGTGG - Intergenic
995831479 5:116360188-116360210 CATTTGGCTGAGATGGGGGCAGG + Intronic
997054368 5:130423265-130423287 TATTGGGCTGTGATGGTTATTGG + Intergenic
998104811 5:139461776-139461798 AAGAGGGCTCAGATGGGGAGGGG - Intronic
1000840898 5:166216894-166216916 TTCTGGGGTGAGATGTGGAGGGG + Intergenic
1001716103 5:173817750-173817772 TGTTGGGCTGAGAAGAGGGGAGG + Intergenic
1001785788 5:174411951-174411973 TATTGGGCAGAGATGGAGAAAGG - Intergenic
1002093315 5:176817262-176817284 TATGTAGCTGAGATGGGGAGGGG + Intronic
1005634197 6:27737920-27737942 TTTTGGGCTGAGAATGGGAAAGG + Intergenic
1006501553 6:34462587-34462609 GATTGGGCAGAGGTAGGGAGAGG - Intergenic
1006509024 6:34511825-34511847 AACTGTGCTGAGCTGGGGAGAGG + Intronic
1006567217 6:34970223-34970245 TATGGGGCTAAGATGGTGATGGG - Intronic
1008979624 6:57468019-57468041 TTTTGGGCTGAGATGATGATGGG + Intronic
1008989483 6:57586366-57586388 AATTAGGCTGAGAGGGGAAGTGG + Intronic
1009167755 6:60360935-60360957 TTTTGGGCTGAGATGATGATGGG + Intergenic
1009178067 6:60484919-60484941 AATTAGGCTGAGAGGGGAAGTGG + Intergenic
1010756663 6:79673154-79673176 GGTTGGGGTGGGATGGGGAGTGG + Intronic
1011772642 6:90691938-90691960 TATTGAGCAGAGATGGGAAGAGG + Intergenic
1012624774 6:101392743-101392765 TAAAGGCCAGAGATGGGGAGGGG - Intergenic
1012935475 6:105363492-105363514 CATTGGGCTTTGATGGGCAGAGG - Intronic
1013431861 6:110062978-110063000 TCTGAGGCAGAGATGGGGAGTGG - Intergenic
1014302463 6:119699676-119699698 TATTGGTATGAGATGGGATGAGG + Intergenic
1016869678 6:148804336-148804358 TATGGAGCTGAGTGGGGGAGGGG - Intronic
1019937317 7:4264983-4265005 CATTGGGTTGGGGTGGGGAGAGG + Intronic
1020463206 7:8446866-8446888 CATTGGAATGAAATGGGGAGGGG - Intronic
1022614481 7:31915243-31915265 TATTAGGCAGAGATTGGGATAGG - Intronic
1022884046 7:34623169-34623191 TAGTGGGAGGAGAAGGGGAGAGG + Intergenic
1025031355 7:55559806-55559828 TGTGGGGCTGACATGGGCAGTGG - Intronic
1028073289 7:86478915-86478937 GGTTGAGCTGAGATTGGGAGTGG + Intergenic
1029125451 7:98292162-98292184 TATGAGGCTGAGATTGGGAAAGG - Exonic
1030864150 7:114678208-114678230 TATTGAGCAGAGATGAGGAAAGG + Intronic
1031011302 7:116526880-116526902 TATTGGGGGGAGATGGGGGAAGG - Intronic
1031046089 7:116889549-116889571 TTTTTGGTAGAGATGGGGAGGGG - Intronic
1031964671 7:128019088-128019110 TAGCTGGCTGAGGTGGGGAGGGG - Intronic
1032082194 7:128865275-128865297 TGTTGGGCTGGGCTGTGGAGGGG - Intronic
1033167496 7:139053025-139053047 GTGTGGCCTGAGATGGGGAGAGG + Intronic
1033291302 7:140085381-140085403 TTTTGGGGGGTGATGGGGAGGGG - Exonic
1033478710 7:141716530-141716552 AGATGGGGTGAGATGGGGAGGGG - Intronic
1034362748 7:150514976-150514998 TATTGGGCTGCGAAGGGCAGTGG + Intronic
1034422061 7:150995622-150995644 TGCAGGGGTGAGATGGGGAGAGG - Intronic
1035062861 7:156082131-156082153 TCCTGGGATGAGATGGGCAGAGG - Intergenic
1036635231 8:10546018-10546040 TGCTGGGCACAGATGGGGAGAGG + Intronic
1037578310 8:20228735-20228757 TAGTGGGCTGAGGTGGGCATGGG - Intergenic
1038454794 8:27666201-27666223 TATTAGGCTGAGAAGCTGAGTGG - Intronic
1040007094 8:42629845-42629867 TGTTGGACTGGGCTGGGGAGGGG + Intergenic
1041043748 8:53872266-53872288 TATTGGAGTGAATTGGGGAGGGG - Intronic
1043392098 8:79801707-79801729 CATTAGGCTGAGATGGGGATGGG + Intergenic
1043502368 8:80870824-80870846 GATGGTGGTGAGATGGGGAGTGG - Intronic
1043922426 8:85998654-85998676 GAGAGGACTGAGATGGGGAGAGG - Intronic
1044886533 8:96784386-96784408 TATTGTTCTGAGGTGGGGGGGGG + Intronic
1047510963 8:125515116-125515138 GATTGGGGTGAGATGGGGAGGGG - Intergenic
1047510987 8:125515341-125515363 GGTTGGGGTGGGATGGGGAGGGG - Intergenic
1048277089 8:133074818-133074840 TATGTGGCAGAGATGGGGTGGGG - Intronic
1048324901 8:133431348-133431370 ATTTGGGCTGAGATCTGGAGAGG - Intergenic
1048351162 8:133617849-133617871 TATGGGGCGGGGAGGGGGAGCGG + Intergenic
1049678534 8:143904592-143904614 CAGAGGGCTGATATGGGGAGGGG - Intergenic
1050169938 9:2804793-2804815 TATAGTCCTGAGATGGGGAAGGG - Intronic
1051148624 9:14057461-14057483 TATTGGGCAGAGGTTGGGTGAGG - Intergenic
1051193929 9:14542801-14542823 TGTTGGAATGAGAAGGGGAGAGG - Intergenic
1052244547 9:26318365-26318387 GATAGGGCTGAAATGGGGTGGGG + Intergenic
1053198061 9:36135613-36135635 TATTTGCCTGACATGGGGAAAGG + Intergenic
1056500475 9:87203814-87203836 TATGGTGCTGAGAGGTGGAGAGG - Intergenic
1058503634 9:105647519-105647541 TGCAGGGCTGAGCTGGGGAGGGG - Intergenic
1059520070 9:114932649-114932671 TGTGGGGCTGAGAAGGGCAGTGG + Intergenic
1060764068 9:126280760-126280782 TAGTGGGCTCAGATGGAGACAGG + Intergenic
1060819256 9:126651987-126652009 TAGTGGCCAGAGATGGGGGGGGG + Intronic
1060823821 9:126676279-126676301 ATTTGGGCTGAGACGGGGAGAGG - Intronic
1061400520 9:130365823-130365845 GGTGGGGCTGAGATGGGGAGGGG - Intronic
1062321265 9:135991461-135991483 CCTTGGGCTGTGATGGGCAGGGG + Intergenic
1062454884 9:136630654-136630676 GAGGGGGCTGAGAAGGGGAGGGG + Intergenic
1185663471 X:1745449-1745471 TGTAGGGCTGAAATGAGGAGAGG + Intergenic
1186366820 X:8904171-8904193 AATTGGGCTGATGTGAGGAGTGG - Intergenic
1189371235 X:40431329-40431351 TCTGGGCCTGTGATGGGGAGGGG - Intergenic
1190953777 X:55171731-55171753 TATGGGGCTGAGAGGGTGTGAGG + Intronic
1191699974 X:64031373-64031395 CATGAGGCTGAGATGGGGAATGG + Intergenic
1191901078 X:66041125-66041147 GTTTGTGCAGAGATGGGGAGTGG + Intergenic
1194481513 X:94431697-94431719 TATTGGGTTGAGATATAGAGAGG - Intergenic
1194946633 X:100076009-100076031 TTTGGGGGTGAGATGGGGTGGGG - Intergenic
1195000837 X:100641847-100641869 TCTTGGGCTGGGATGGGCTGGGG + Intergenic
1196194140 X:112822511-112822533 CATTGGGTTGTGGTGGGGAGAGG + Exonic
1196495037 X:116314746-116314768 AAGTGGACTGAGATGGGGATAGG - Intergenic
1196755267 X:119151875-119151897 TATGGGACTGAGATTGGGAAAGG - Intergenic
1196939796 X:120763725-120763747 TCTTGGCCTTAGCTGGGGAGGGG + Intergenic
1198020606 X:132653816-132653838 TGTTGTGCTGAGATGGGGTAGGG + Intronic
1200091547 X:153638397-153638419 TGCTGGGAGGAGATGGGGAGTGG + Intergenic
1200569268 Y:4807950-4807972 TTTTGGGCTGAAATGGAGAAAGG - Intergenic