ID: 914406341

View in Genome Browser
Species Human (GRCh38)
Location 1:147377494-147377516
Sequence CTGTGGCTCTTGGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914406341_914406347 13 Left 914406341 1:147377494-147377516 CCTTCTTCCTCCAAGAGCCACAG No data
Right 914406347 1:147377530-147377552 TCTCTTTCTTAGTAATACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914406341 Original CRISPR CTGTGGCTCTTGGAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr