ID: 914412190

View in Genome Browser
Species Human (GRCh38)
Location 1:147440600-147440622
Sequence GACAAAATGGTGACTTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914412184_914412190 10 Left 914412184 1:147440567-147440589 CCCTGTTCATGTCTGTTGCAGGA No data
Right 914412190 1:147440600-147440622 GACAAAATGGTGACTTGGACTGG No data
914412185_914412190 9 Left 914412185 1:147440568-147440590 CCTGTTCATGTCTGTTGCAGGAG No data
Right 914412190 1:147440600-147440622 GACAAAATGGTGACTTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914412190 Original CRISPR GACAAAATGGTGACTTGGAC TGG Intergenic
No off target data available for this crispr