ID: 914420012

View in Genome Browser
Species Human (GRCh38)
Location 1:147520538-147520560
Sequence GTCTCAGTTTTCTCATGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914420012_914420018 24 Left 914420012 1:147520538-147520560 CCCACCCATGAGAAAACTGAGAC No data
Right 914420018 1:147520585-147520607 AAGATCACGTAGCCAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914420012 Original CRISPR GTCTCAGTTTTCTCATGGGT GGG (reversed) Intergenic
No off target data available for this crispr