ID: 914420371

View in Genome Browser
Species Human (GRCh38)
Location 1:147523189-147523211
Sequence AGGGTGCCCACTCAGTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914420365_914420371 25 Left 914420365 1:147523141-147523163 CCTTAGAGAAGCAGGGCAACTTA No data
Right 914420371 1:147523189-147523211 AGGGTGCCCACTCAGTCCAGAGG No data
914420364_914420371 26 Left 914420364 1:147523140-147523162 CCCTTAGAGAAGCAGGGCAACTT No data
Right 914420371 1:147523189-147523211 AGGGTGCCCACTCAGTCCAGAGG No data
914420368_914420371 2 Left 914420368 1:147523164-147523186 CCTTCTCGAAAAGGCAGGAAGTA No data
Right 914420371 1:147523189-147523211 AGGGTGCCCACTCAGTCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914420371 Original CRISPR AGGGTGCCCACTCAGTCCAG AGG Intergenic
No off target data available for this crispr