ID: 914425012

View in Genome Browser
Species Human (GRCh38)
Location 1:147567771-147567793
Sequence CCTAGCAGGGGGAGGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 983
Summary {0: 1, 1: 0, 2: 2, 3: 89, 4: 891}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914425012_914425027 29 Left 914425012 1:147567771-147567793 CCCTTCCCCCTCCCCCTGCTAGG 0: 1
1: 0
2: 2
3: 89
4: 891
Right 914425027 1:147567823-147567845 GATCCCCTTATCTACTTCCAGGG No data
914425012_914425026 28 Left 914425012 1:147567771-147567793 CCCTTCCCCCTCCCCCTGCTAGG 0: 1
1: 0
2: 2
3: 89
4: 891
Right 914425026 1:147567822-147567844 AGATCCCCTTATCTACTTCCAGG 0: 1
1: 0
2: 2
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914425012 Original CRISPR CCTAGCAGGGGGAGGGGGAA GGG (reversed) Intronic
900184320 1:1325823-1325845 CATCGGTGGGGGAGGGGGAAGGG - Intronic
900192785 1:1358566-1358588 CTAAGGAGGGGGAGGGGGTAGGG - Intronic
900342637 1:2195956-2195978 CCGGGCAGGGGGAGGGGGCCTGG + Intronic
900647710 1:3716503-3716525 ACTAGCCTGGGGAGGGGGAAAGG - Intronic
900919769 1:5662778-5662800 CCCAGCAGGGGCAGGAGGCAGGG + Intergenic
901086353 1:6614243-6614265 CCGAGCAGGGGGCGGGGGTTGGG - Intronic
901240001 1:7687376-7687398 CCAAGCAGGGGGAGGTGGGTAGG + Intronic
901282418 1:8049269-8049291 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
901694605 1:10997498-10997520 CCTAGGAGGGGGAGGGGAGAGGG + Intergenic
902216465 1:14937390-14937412 CCTTGAAGATGGAGGGGGAAGGG - Intronic
902348360 1:15835558-15835580 CCCAGCACGGGGAGAGGGCAGGG - Intergenic
902754878 1:18542372-18542394 CCTAGGAGGGGGATGGGGAGCGG + Intergenic
903034899 1:20486787-20486809 TCCAGGAGGGGGAGGGGGAGAGG + Intergenic
903068592 1:20715463-20715485 CCTCGCAGAGGGAAGGGGCAGGG - Intronic
903255057 1:22091686-22091708 ACTAGTACTGGGAGGGGGAAGGG - Exonic
903282388 1:22257404-22257426 GGTAGGAGGGGGAGGAGGAAGGG - Intergenic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903471972 1:23593632-23593654 CCTGGCAGGGAGGGTGGGAATGG + Intronic
903556812 1:24199887-24199909 CCGAGAAGTGGGAGGGGGGAGGG + Intergenic
903668518 1:25022291-25022313 GGTAGGAGGGGGAGGGGCAAGGG - Intergenic
904613871 1:31739434-31739456 CCTGGCAGGGGGAGGGGCCCAGG - Exonic
904773493 1:32893701-32893723 CCTAGCGAGGGGAGGCGGAGCGG - Intronic
905312126 1:37056610-37056632 CCCAGCAGGGGGAGGGCAGAAGG - Intergenic
905648220 1:39639502-39639524 CCGAGCAGGCGGAGGGCGAGCGG - Intronic
905769998 1:40631227-40631249 CCTAAGAGAGGGAGGGGGCAGGG + Intronic
906123787 1:43413807-43413829 GGTAGCTGGGGGAGGTGGAAGGG + Intronic
906151738 1:43591619-43591641 CACAGCCGAGGGAGGGGGAAAGG - Intronic
906288127 1:44601678-44601700 CCTAGCAGAGAGAGGGGGACAGG + Intronic
906507948 1:46394121-46394143 CCGAGCAGGCGGGTGGGGAAGGG - Intergenic
906617156 1:47241265-47241287 GGTGGCAGGAGGAGGGGGAAGGG + Intergenic
907019437 1:51052093-51052115 CCAAGCAGGGGGAGAGAGATGGG + Intergenic
907267746 1:53272970-53272992 CCTGAAAGGGGGAAGGGGAAAGG + Intronic
907598158 1:55739468-55739490 CCTATCAGGGGGACAGGGGAAGG - Intergenic
907675610 1:56515349-56515371 GCATGCAGGGGCAGGGGGAATGG - Intronic
907686171 1:56613988-56614010 CCTGTCATGGGGTGGGGGAATGG + Intronic
908193301 1:61725164-61725186 CCCAGGAGCGGGAGGGAGAAGGG + Intronic
908312347 1:62897283-62897305 GTTACCAGGGGGAGGGGGAGGGG + Intergenic
908668413 1:66518301-66518323 CCTAGCAGAGGGTGGAGGATGGG + Intergenic
908707555 1:66976076-66976098 CCCAGCAGGGGGTGGGGGTGGGG - Intronic
909871951 1:80752154-80752176 TCTAGGAAGGGGAGGAGGAAGGG + Intergenic
909907399 1:81215400-81215422 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
910155030 1:84207219-84207241 GAGAGCAGGGGGAGGGAGAATGG + Intronic
910597406 1:88993932-88993954 ATTAGCTGGGGGAGGAGGAAAGG + Intergenic
911348562 1:96724671-96724693 CATAATGGGGGGAGGGGGAAGGG + Intronic
912613503 1:111073673-111073695 CCTGTCATGGGGTGGGGGAATGG - Intergenic
912797197 1:112700440-112700462 CCCAGGAGCGGGAGGGTGAAGGG + Exonic
913093714 1:115497065-115497087 GTTGGCTGGGGGAGGGGGAAAGG - Intergenic
913370089 1:118089040-118089062 TCTAGTAGGAGGACGGGGAAGGG + Intronic
913463182 1:119111556-119111578 TCCAGCAGGGAGAAGGGGAAAGG - Intronic
914425012 1:147567771-147567793 CCTAGCAGGGGGAGGGGGAAGGG - Intronic
914992962 1:152514561-152514583 CCTAGCAGGGTCTGGGGGAGAGG + Intronic
915076654 1:153313171-153313193 ACCAGCAGGGGCAGGAGGAAGGG + Intergenic
915118687 1:153615526-153615548 CCGAGCAGGGGGTGGGGGAGAGG - Intronic
915136294 1:153733934-153733956 CCTGGCTGAGGGAGGGGAAATGG + Intronic
915145735 1:153794964-153794986 CCTGGTGGCGGGAGGGGGAAGGG + Intergenic
915146331 1:153797820-153797842 ACTGGCAGGGGAAGGGGGAACGG + Intergenic
915251479 1:154592275-154592297 CTTAGGAAGGAGAGGGGGAAGGG - Intronic
915267264 1:154727971-154727993 CCTAGCGAGAGGAGGGAGAATGG - Intronic
915339312 1:155167564-155167586 CCTAGGGCGGGGAGGGGGGAAGG - Intergenic
915520485 1:156439566-156439588 CGAAAGAGGGGGAGGGGGAAAGG + Intergenic
915840425 1:159208564-159208586 TGTAGCAGGGGGCGGGGGTAGGG - Intergenic
916718558 1:167465206-167465228 CCTAGCAGGGTGGTGGGGAGGGG - Intronic
917047141 1:170873550-170873572 CTCTGCAGGGGGAGGGGAAAAGG - Intergenic
918016987 1:180644737-180644759 CATACCAGGGGGAGGGGGAGTGG + Intronic
918224230 1:182465456-182465478 CCTATCATGGGGTGGGGGGAGGG + Intronic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
918525608 1:185461075-185461097 CCTGTCAGGGGGTGGGGGCAAGG + Intergenic
920068466 1:203286048-203286070 CCTAGAAGTGGGATGGAGAAGGG - Intergenic
920072754 1:203314772-203314794 CCTGTCAGGGGGTGGGGGACTGG + Intergenic
920350638 1:205335796-205335818 CCCAGCCCTGGGAGGGGGAAGGG + Intergenic
920459091 1:206124538-206124560 GCTGGGAGTGGGAGGGGGAATGG - Intergenic
920508128 1:206531451-206531473 CCTAGCTGGGGGAGCTGGCAGGG + Intronic
920679413 1:208060897-208060919 CCTCCCTGGGGGAGGGGGAAGGG - Intronic
920760764 1:208781889-208781911 TTTAGGAGGGGGAGCGGGAAGGG - Intergenic
921443896 1:215221631-215221653 CTTAGTAGGAGGTGGGGGAAAGG + Intronic
922592355 1:226786869-226786891 CCTCCCTGGAGGAGGGGGAAAGG + Intergenic
922718043 1:227887160-227887182 CCGGGCAGGGGGCGGGGGACTGG + Intergenic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
923699923 1:236290597-236290619 CCTGGCAGGTGGGTGGGGAAGGG - Intergenic
923723519 1:236487127-236487149 CCAGGCAGTGGGAGAGGGAAAGG + Intergenic
924295631 1:242584754-242584776 CCTACCAGGAGGCGGGGCAAAGG + Intergenic
924333932 1:242967951-242967973 CTTAGCAGGGGTAGGGGGACGGG - Intergenic
924416148 1:243858747-243858769 CCTGGCACTGGGAGGAGGAATGG + Intergenic
1062777814 10:169010-169032 TCTTGGAGCGGGAGGGGGAAAGG + Intronic
1062824507 10:557873-557895 GCAGGCAGGGGGAGGGGGCAGGG + Intronic
1063371679 10:5526373-5526395 CCTATACGGGGGAGCGGGAAAGG + Exonic
1063975941 10:11415586-11415608 TCTGGCAGTAGGAGGGGGAAAGG + Intergenic
1064271566 10:13870686-13870708 CCTAGCAGGAGGGGAGGGGAGGG - Intronic
1065081890 10:22137297-22137319 CCTAGCAAGTGGAGGAGGCAGGG + Intergenic
1065193184 10:23234518-23234540 CCTACCAGAGGGAGGAGGATGGG + Intronic
1065255790 10:23866608-23866630 CCAAGCAGGGGTAGGGTGCACGG - Intronic
1066154977 10:32666524-32666546 CCTATCATGGGGTGGGGGGAGGG - Intronic
1066442544 10:35451814-35451836 CATGGCAGGGGCAGGGGGAGCGG + Intronic
1066749307 10:38636235-38636257 ACTTGAAGGGTGAGGGGGAACGG + Intergenic
1066967343 10:42281557-42281579 ACTTGAAGGGTGAGGGGGAACGG - Intergenic
1067080722 10:43210855-43210877 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067080751 10:43210983-43211005 CCTTGCAGGGAGTGGGGGACAGG + Intronic
1067437464 10:46288171-46288193 CCCAGCAGGAGGAGCAGGAAAGG - Intronic
1067541038 10:47153385-47153407 CATAGCAGGTGGTGGGGGATGGG - Intergenic
1068203908 10:53822467-53822489 AATAGGAGGAGGAGGGGGAAGGG + Exonic
1068608172 10:59029263-59029285 CCTATCATGGGGTGGGGGGAGGG - Intergenic
1069449260 10:68502836-68502858 GAAAGGAGGGGGAGGGGGAAGGG + Intronic
1070460122 10:76658067-76658089 CCTAGATGGGGGAGGGTGGAAGG + Intergenic
1070509692 10:77149262-77149284 CATGGCAGGGGCAGGGAGAAGGG - Intronic
1071084037 10:81847210-81847232 CCTGTCATGGGGTGGGGGAATGG + Intergenic
1071258437 10:83896445-83896467 CCTGGCAGGGGGAGGTGAACAGG - Intergenic
1072119909 10:92397044-92397066 TCCTGCAGGGGGAGGGGGAAAGG + Intergenic
1073121859 10:101126807-101126829 CCGGGCTGGGGGAGGAGGAAAGG - Intronic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073332291 10:102678226-102678248 CCTGGCAGCAGCAGGGGGAAGGG + Intronic
1073835640 10:107438003-107438025 TCCAGCAGAGGGAGGGGAAAAGG - Intergenic
1074120066 10:110487528-110487550 TCTGGCAGAGGGAGGGGGAAGGG - Intergenic
1074150980 10:110759599-110759621 CCCAGCAGGGGCAGAGGGAGGGG + Intronic
1074702910 10:116108048-116108070 CCTGGGAGGGGGTGGGGAAAGGG + Intronic
1074815000 10:117136694-117136716 CCAAGGAGGTGGAGGGGGACGGG - Intronic
1074886590 10:117698865-117698887 CAGAGCAGGAAGAGGGGGAAAGG + Intergenic
1074926267 10:118075396-118075418 TCTGGCAGGGGGAGGAGAAAAGG - Intergenic
1075196277 10:120362008-120362030 CCTAGAAGGAGGAGAGGGATTGG - Intergenic
1075200004 10:120394705-120394727 CCTCACAAGGGAAGGGGGAAGGG + Intergenic
1075296318 10:121278782-121278804 CCTGTCAGGGGGTGGGGGGAAGG + Intergenic
1075645563 10:124093729-124093751 ACTCGGAGGGGGAGGGGGCAGGG - Intergenic
1075724818 10:124605838-124605860 CAGTGGAGGGGGAGGGGGAAGGG + Intronic
1075800714 10:125151912-125151934 CGGAGCGGGGGGAGGGGGCAGGG + Intronic
1075951572 10:126482241-126482263 CTTATGAGGGGGAGGGGAAAGGG + Intronic
1076255691 10:129022754-129022776 CCTAGAGGGGGGAGGGGGCGGGG - Intergenic
1076312525 10:129518536-129518558 GGGAGGAGGGGGAGGGGGAAGGG - Intronic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076601287 10:131658569-131658591 TCGAGCAGGGTGAGGAGGAAGGG + Intergenic
1076667743 10:132102656-132102678 CCTCACAGAGGGAGGGTGAAAGG - Intergenic
1076702138 10:132279039-132279061 CCATGCAGGGGGCGGGGGACGGG + Intronic
1076755951 10:132571837-132571859 GGTAGCAGGTGGAGGGGGCAGGG + Intronic
1076865762 10:133165473-133165495 CCCCGCAGGGGGACGGGGACCGG + Intronic
1077046994 11:551110-551132 ACCTGCAGGGGGAGGGGGAGGGG - Exonic
1077107478 11:848396-848418 CCTCGCTGGGGGAAGGGGACAGG - Intronic
1077331616 11:1986492-1986514 CCGAGCAGGGGCTGGGGGCACGG + Intergenic
1077481870 11:2818741-2818763 GCTAGCCTGGGCAGGGGGAAAGG - Intronic
1077601953 11:3580630-3580652 CCTAGCAGGGGAAGGGGCGGGGG - Intergenic
1077651945 11:3980871-3980893 ACTGGAAGGGGGAAGGGGAAAGG - Intronic
1078086174 11:8234162-8234184 TCTAGCAGGGGGTGGAGGCAGGG + Intronic
1078789709 11:14530137-14530159 CCTAGCAGGGGGGTAGGGCAGGG - Intronic
1079239895 11:18714821-18714843 CATGGGAGGGGGATGGGGAAAGG + Intronic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1080596345 11:33777171-33777193 GGTGGCAGGGGGTGGGGGAAGGG - Intergenic
1080784961 11:35466915-35466937 CATAGGATGGGGAGGGGAAAAGG - Intronic
1080872820 11:36251913-36251935 CCCAGCAGGGGATGGGGCAAAGG + Intergenic
1081410431 11:42751558-42751580 CCTGTCGGGGGGTGGGGGAAGGG - Intergenic
1081538974 11:44016392-44016414 CTGAGCTGGGGGAGGGGGAATGG + Intergenic
1081621266 11:44620269-44620291 CCTTGTAGGGGGAGAGGGGAGGG + Exonic
1081798383 11:45839008-45839030 CCTATCAGGGGGTGGGGGCTAGG + Intergenic
1081809857 11:45908674-45908696 TGTAGCAGTGGGAGGGGCAATGG - Intergenic
1081986285 11:47306624-47306646 CCTAGATGGGGGAAGGGGGATGG + Intronic
1082111691 11:48283883-48283905 CCTATCAGGGGTTGGGGGGAAGG - Intergenic
1082783575 11:57304258-57304280 CCAAGCAGGAAGAGGGGGCAGGG + Intronic
1082871178 11:57944631-57944653 CCGGGGAGGGGGAGGGGGAGGGG + Intergenic
1083091635 11:60205925-60205947 CCCAGCAGAAGGTGGGGGAAGGG + Intronic
1083144608 11:60749064-60749086 CCAAGCTTGGGGAGTGGGAAGGG + Intergenic
1083252618 11:61478032-61478054 TTTAGCAGGTGGAGGGGGCAAGG - Intronic
1083470631 11:62881573-62881595 CCGGGGAGGGGGTGGGGGAAGGG - Intronic
1083575050 11:63784289-63784311 TCCAGCAGTGGGAGGGGAAAAGG + Intergenic
1083696629 11:64447805-64447827 GCCAGGAAGGGGAGGGGGAAAGG - Intergenic
1083887281 11:65579060-65579082 GCTGCCTGGGGGAGGGGGAAGGG - Exonic
1083890511 11:65593440-65593462 CCTAACAGCGTGTGGGGGAAGGG - Intronic
1084257862 11:67955176-67955198 CCTAGCAGGGGAAGGGGCGGGGG - Intergenic
1084263348 11:67992374-67992396 TCCAGCAGTGGGTGGGGGAAGGG - Intronic
1084774143 11:71364482-71364504 CCTGGCAGGGGCAGGGAGAGTGG + Intergenic
1084810059 11:71606753-71606775 TCCAGCAGTGGGTGGGGGAAGGG + Intergenic
1085048056 11:73364600-73364622 GGTAGCAGGGGGTGGGGGAATGG + Exonic
1085323958 11:75592572-75592594 CATAGCAGGTGGTAGGGGAAGGG - Intronic
1085458798 11:76680895-76680917 CCCAGCAGGGAGAGGGAGGAGGG - Intergenic
1085474773 11:76783057-76783079 GCGCGCAGGGGGAGGGGGCAGGG + Intronic
1085656037 11:78316031-78316053 TATGGCAGGGGGAGGGGGAGTGG - Intronic
1086872886 11:92060547-92060569 CATGGCAAGGGGAGGGCGAAAGG + Intergenic
1086972576 11:93099443-93099465 CCTAGCAGGGTGAGCAGGAAGGG - Intergenic
1087284243 11:96247575-96247597 CCTAGCAGGGACAGGGGCAGGGG - Intronic
1087820422 11:102705413-102705435 GCTGGCACAGGGAGGGGGAAAGG - Intronic
1087898824 11:103617303-103617325 CCTATCAGGGGGTGGGGGGCTGG + Intergenic
1088103284 11:106177492-106177514 CCGTGGAGGGGGAGGGGGAGGGG + Intergenic
1088380377 11:109186435-109186457 CCTATCATGGGGTGGGGGGAGGG - Intergenic
1088430991 11:109758515-109758537 ACTAGCAGGGGTAGGGGGAATGG - Intergenic
1088913745 11:114211618-114211640 CCAATGCGGGGGAGGGGGAAGGG - Intronic
1089784686 11:120899512-120899534 CATGGCAGGGGGACAGGGAAGGG - Intronic
1089935129 11:122356872-122356894 CCTGGTGGGGGGAGGGGGGAGGG - Intergenic
1090143546 11:124292956-124292978 TCTGGCAGGGGGAGTGGAAAAGG - Intergenic
1090265065 11:125348460-125348482 CCAAGGAGGGGGAGGGGCCAGGG + Intronic
1090394701 11:126411101-126411123 CCTGGCAGTGGGAAGGGAAAAGG + Intronic
1090402848 11:126460104-126460126 GGGAGCAGGAGGAGGGGGAAGGG + Intronic
1090443963 11:126747793-126747815 CCAAGCAGAGGGAGGGGAACAGG - Intronic
1090730108 11:129565126-129565148 CCTCCCAGGAGGAGGGGGCAGGG + Intergenic
1090776301 11:129968782-129968804 CCCAGCAGGGGGATGGTGAGTGG - Intronic
1091059992 11:132452305-132452327 CCAAGCTGGGGGAGGATGAAAGG + Intronic
1091207770 11:133833056-133833078 GCGAGGAGGGGGAGGGGGAGGGG + Intergenic
1091235542 11:134019918-134019940 CCGACCAAGGGGAAGGGGAATGG + Intergenic
1091290598 11:134437389-134437411 CCTGGCAGGGGCAGCGGGGAAGG - Intergenic
1202814597 11_KI270721v1_random:41668-41690 CCGAGCAGGGGCTGGGGGCACGG + Intergenic
1091900220 12:4138536-4138558 CCTGCCATGGGGTGGGGGAACGG - Intergenic
1091915772 12:4271195-4271217 CGGAGTAGGGGGAGGGGGAGAGG + Intergenic
1092241934 12:6840798-6840820 GCTGGCAGGGGTGGGGGGAAGGG - Intronic
1092702744 12:11250831-11250853 CCTATCAGGAGGTGGGGGGAAGG - Intergenic
1093220635 12:16416531-16416553 CGTGGCAGGGTGAGGGGGCAGGG + Intronic
1093275594 12:17121122-17121144 CCTATCGTGGGGTGGGGGAAGGG + Intergenic
1093407795 12:18826331-18826353 AGTAGCAGGGGCAGGGGGAAGGG - Intergenic
1094376296 12:29790857-29790879 CCTGTCAGGGGGTGGGGGCAAGG + Intergenic
1094770503 12:33652796-33652818 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
1096189973 12:49610112-49610134 CCTAGGCAGGGGAGAGGGAAAGG + Intronic
1096870354 12:54588697-54588719 CCGGGCTGGGGGAGGGGGAGGGG - Intergenic
1096978365 12:55713919-55713941 ACTTGCAGGGGGAGGAGAAATGG - Intronic
1097017627 12:55998536-55998558 CCTGTCAGGGGCAGGGGGAGGGG + Intronic
1097113015 12:56676124-56676146 GCTGGGAGGGGGAGGGGGAGGGG + Intronic
1097173244 12:57128851-57128873 CAGAGAAGGAGGAGGGGGAAAGG + Exonic
1097911756 12:64977933-64977955 CCTGTCCAGGGGAGGGGGAATGG - Intergenic
1099022392 12:77422940-77422962 CCTGTCAGGGGGTGGGGAAAAGG - Intergenic
1099151554 12:79120287-79120309 ACTAGAAGGGGGAGAGAGAAAGG + Intronic
1099319607 12:81129773-81129795 CCTATCATGGGGTGGGGGGAGGG - Intronic
1099764710 12:86969017-86969039 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
1099959178 12:89380407-89380429 AGGAGAAGGGGGAGGGGGAAGGG - Intergenic
1100375372 12:94010578-94010600 GCAATCAGGGAGAGGGGGAATGG + Intergenic
1100469446 12:94876794-94876816 TATTCCAGGGGGAGGGGGAAAGG + Intergenic
1100593086 12:96047470-96047492 CCAAGCTGGGGTAGGGAGAAGGG - Intergenic
1101032787 12:100676635-100676657 GCTGGCAGGGGCAGCGGGAAAGG + Intergenic
1101083168 12:101209452-101209474 CCATGCAGGGCGCGGGGGAAGGG - Intronic
1101593010 12:106139531-106139553 CGGAGCTGGGGGAGGGGGCAGGG + Exonic
1102247846 12:111366533-111366555 CCTAGAATGGGGAGGTGGAGTGG - Intronic
1102532261 12:113555195-113555217 CCAAAATGGGGGAGGGGGAAGGG + Intergenic
1103425507 12:120830384-120830406 GGAAGAAGGGGGAGGGGGAAGGG + Intronic
1103425522 12:120830412-120830434 GGAAGAAGGGGGAGGGGGAAGGG + Intronic
1103425537 12:120830440-120830462 GGAAGAAGGGGGAGGGGGAAGGG + Intronic
1103425553 12:120830469-120830491 GGAAGAAGGGGGAGGGGGAAGGG + Intronic
1103782523 12:123408685-123408707 CCCAGCAGGATGAGGGGGAATGG - Exonic
1103949450 12:124543079-124543101 CCTAGCTGGTGGAGGAGGGATGG - Intronic
1104426788 12:128684506-128684528 CCCAGCTTGGGGAGGAGGAAGGG - Intronic
1104983001 12:132582385-132582407 GGGAACAGGGGGAGGGGGAACGG - Intronic
1105204734 13:18211459-18211481 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1105217800 13:18299707-18299729 CCCAGCAGGATGAGGGGGAATGG - Intergenic
1105894238 13:24704947-24704969 CTTAGCAGGTGTAAGGGGAAAGG + Intronic
1106360763 13:29028536-29028558 CCAAGCAGAGGGAGGTGCAAAGG - Intronic
1106913673 13:34489071-34489093 CCTAGCATCGGGGGTGGGAAGGG + Intergenic
1107980167 13:45727593-45727615 TCTGGCAGGAGGAGGGGAAAAGG - Intergenic
1108156593 13:47591539-47591561 CCTGTCATGGGGTGGGGGAAGGG + Intergenic
1108373489 13:49792813-49792835 CCTTGCAGGGGAAGAGGGCAGGG - Exonic
1108404083 13:50082149-50082171 CCTGGCGGGAGGAGGGGGGAGGG - Exonic
1108989322 13:56634762-56634784 CCTGTCATGGGGTGGGGGAATGG + Intergenic
1110041691 13:70767884-70767906 CTTAGCGGGGGGCAGGGGAAGGG + Intergenic
1110159595 13:72359570-72359592 CCTGTCATGGGGAGGGGGGAGGG + Intergenic
1110487668 13:76065971-76065993 CATTGCTGGGGGATGGGGAAGGG + Intergenic
1110781716 13:79473802-79473824 CCTGTCAGGGGGTGGGGGACTGG - Intergenic
1111143651 13:84154538-84154560 CTTTGCATGGGGATGGGGAATGG + Intergenic
1111702754 13:91711447-91711469 CCTGTCAGGGGGTGGGGGACTGG + Intronic
1111850443 13:93566712-93566734 CCTGTCAAGGGGAGGGGGCAAGG - Intronic
1111899906 13:94188095-94188117 ACTGGCAGGGGGATGGAGAAGGG - Intronic
1112638770 13:101247801-101247823 CCTATCAGGAGGTGGGGGGAGGG - Intronic
1112807307 13:103176980-103177002 CCTGTCAGGGGTCGGGGGAAAGG - Intergenic
1113164985 13:107430431-107430453 GGGAGCAGGGGGAGGGGGAAGGG - Intronic
1113595385 13:111528241-111528263 ACAAACAGGGGGAGGGGGAAAGG - Intergenic
1113696253 13:112348335-112348357 CCTGGCATGGGGACAGGGAAAGG - Intergenic
1113995029 14:16057759-16057781 GCCTGCGGGGGGAGGGGGAAGGG - Intergenic
1114452860 14:22837972-22837994 CCTAGAAGGGGGATGGGATATGG + Intronic
1114467134 14:22931006-22931028 CGGGGCAGGGGGAGGAGGAAAGG + Intergenic
1114737867 14:25061619-25061641 CCCAGCTTGGGGAGTGGGAAGGG + Intergenic
1114896428 14:26996195-26996217 CACAGCATGGTGAGGGGGAAGGG + Intergenic
1115941397 14:38614253-38614275 ACTAGAAAGGGGAGGGGAAAAGG + Intergenic
1115962972 14:38856638-38856660 CCTGTCAGGGGGTGGGGGCAAGG - Intergenic
1116128270 14:40818169-40818191 CCTGTCATGGGGTGGGGGAATGG - Intergenic
1116728605 14:48593722-48593744 CCTGTCATGGGGTGGGGGAATGG + Intergenic
1117438506 14:55740045-55740067 CCTAGTAGGAGCAGGAGGAAAGG - Intergenic
1117521416 14:56555048-56555070 CCTTTCTGGGGGAGGGGAAAGGG - Intronic
1117561273 14:56941923-56941945 TCTTTCAGGGTGAGGGGGAAGGG - Intergenic
1117776427 14:59188981-59189003 CCTAGCTGGGGGTGGGAAAATGG + Intronic
1118295095 14:64561253-64561275 TCAAGCTGGGGGAGGGGAAAGGG - Intronic
1118678494 14:68214449-68214471 TCTAGCATGGGGAGGTGGAGGGG + Intronic
1119291468 14:73498603-73498625 CCCAGCAGGGTGATGGGGAAAGG + Intronic
1119581923 14:75792216-75792238 CCTATCATGGGGTGGGGGGAGGG + Intronic
1119585559 14:75831637-75831659 GCTAGCAGGGGGAGTGGGTGGGG + Intronic
1119853775 14:77884414-77884436 CCCAGCAAGGGGGTGGGGAAGGG + Intronic
1119911150 14:78350400-78350422 AATAGTAAGGGGAGGGGGAAAGG + Intronic
1120862525 14:89267455-89267477 TCTGGCTGGGGGAGGGGAAATGG + Intronic
1121255116 14:92525345-92525367 CCTGGCAGGGTGTGGGGGGATGG + Intronic
1121788656 14:96682174-96682196 CCTCTCAGGGGGAGGGGCAGAGG + Intergenic
1122254293 14:100465358-100465380 CAGGGCTGGGGGAGGGGGAATGG - Intronic
1122334382 14:100960312-100960334 CCTGGCAGGGCCAGTGGGAAGGG - Intergenic
1122347130 14:101067540-101067562 CCTGGCAGAGGGAGGGGCACTGG - Intergenic
1122369600 14:101222058-101222080 CCCAGCAGGGGCAGGGGCAGCGG - Intergenic
1122614395 14:103007267-103007289 CATAGCAGGGAAAGGGGAAATGG + Intronic
1122782244 14:104148658-104148680 CCGGGGAGGGGGAGGGGGAGGGG + Intronic
1122878457 14:104679359-104679381 CCTGGGGGAGGGAGGGGGAAGGG + Intergenic
1123032390 14:105458164-105458186 GCTGGGACGGGGAGGGGGAAGGG - Intronic
1123923968 15:25090467-25090489 CCTGGCAGTGGGAAGGGGAGAGG + Intergenic
1124142048 15:27086225-27086247 CCTAGGAGCAGGAGGAGGAAGGG + Intronic
1124383628 15:29188409-29188431 CCTGTCAGGGGGTGGGGGCAAGG - Intronic
1125258024 15:37789140-37789162 CCTAGAAGAGGGACAGGGAAAGG + Intergenic
1126201804 15:45995129-45995151 CATAGCAGTGGCAGTGGGAATGG - Intergenic
1126690791 15:51287599-51287621 CAGGGCAGAGGGAGGGGGAAAGG - Intronic
1126855002 15:52829974-52829996 CCTGTCAAGGGGTGGGGGAATGG + Intergenic
1127261911 15:57332573-57332595 CCTGGCAGGGTGAGAGGGATGGG - Intergenic
1128325387 15:66720725-66720747 TCTAGCACGGGGAAGGGGATGGG + Intronic
1128537611 15:68502686-68502708 GCTGGCATGGGGTGGGGGAAAGG + Intergenic
1128743725 15:70099564-70099586 CAGAGAAGGGGGAGGGGGAAAGG - Intergenic
1128767904 15:70262283-70262305 CAAAGCAGGGGGAGAGGGAGGGG - Intergenic
1128903153 15:71443624-71443646 CCCAGCAGGGGGACCTGGAAGGG - Intronic
1129148549 15:73671779-73671801 CACAGCACGGGGAGGGTGAAAGG - Intergenic
1129253172 15:74319688-74319710 CCTAGGAGGGGAAGTAGGAATGG + Intronic
1129868073 15:78924091-78924113 CCCAGCGGGGGGGGGGGGGAGGG + Intronic
1130018344 15:80204438-80204460 CCGGGCTGGGGGAAGGGGAATGG - Intergenic
1131144413 15:90001894-90001916 GAGAGGAGGGGGAGGGGGAAGGG + Intronic
1131455568 15:92580132-92580154 CCTTGCAGCGGGAGGTGGGAGGG - Intergenic
1131475121 15:92731820-92731842 ACTAGAAGGGGGAGGGTGGAAGG + Intronic
1131494929 15:92900120-92900142 CCCAACAGGGGGAGGGGGGAGGG - Exonic
1131917031 15:97278878-97278900 CCTATCAGGGGGTGGGGGGCGGG - Intergenic
1131943495 15:97593250-97593272 CCTGTCACGGGGTGGGGGAAAGG + Intergenic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132650591 16:1019824-1019846 CCTAGCACGTGGACGGGAAAGGG - Intergenic
1132662668 16:1068602-1068624 CATAGCGGGGGGAGGAGGAAGGG - Intergenic
1132771057 16:1563747-1563769 CCTAGCATGGGGTCTGGGAAAGG - Intronic
1132972957 16:2697808-2697830 CATTGCAGGGGCAGGGGCAAGGG + Intronic
1133112101 16:3554185-3554207 CCTTGGAGGAGGAGGGAGAAGGG + Intronic
1133281331 16:4667076-4667098 CCTAGGAGTCGGAGGGGGAAAGG + Intronic
1133360170 16:5167936-5167958 CCTAGTGGGGGGAGGGGGAGGGG + Intergenic
1133420058 16:5638394-5638416 CCTAGCAGGGGGAGGGCTTCTGG + Intergenic
1133448587 16:5884468-5884490 CCTAGCCGGGGGCGGGGGTAGGG - Intergenic
1134449250 16:14353831-14353853 AGTAGAAGGGGGAGGGAGAAAGG + Intergenic
1134573268 16:15309837-15309859 GGAAGCAGGGGGAGGGGGAAGGG - Intergenic
1134895349 16:17881454-17881476 CCTATCACAGGGAGGAGGAATGG - Intergenic
1135047843 16:19168945-19168967 CCAAGGAGAGGGAGGGGGCAGGG - Intronic
1135728798 16:24877387-24877409 CCTAGCAGAGGCAGTGGGCAGGG + Intronic
1135736091 16:24932797-24932819 GCTGGGAGGGGTAGGGGGAAAGG + Intronic
1136030500 16:27499355-27499377 CCCAGCAGGGAGAGGTGGAGTGG + Intronic
1136228566 16:28874099-28874121 CGAGGCAGGGTGAGGGGGAAGGG + Exonic
1136234006 16:28903568-28903590 CCCTGCAGGCGCAGGGGGAACGG - Intronic
1136733408 16:32440898-32440920 ACTTGAAGGGTGAGGGGGAACGG - Intergenic
1137273570 16:46918770-46918792 CCCAGCAGTGGCAGAGGGAAGGG - Intronic
1137291154 16:47052852-47052874 CCTAGCAGGGAGAGAGGAAAAGG + Intergenic
1137401116 16:48155164-48155186 CCAAGCTGGGGGTGTGGGAAGGG + Intronic
1138483471 16:57319430-57319452 CCTGTCAGGGGGTGGGGGCAAGG + Intergenic
1138673784 16:58636261-58636283 CCTGTCAGGGGGTGGGGGCAAGG + Intergenic
1138887446 16:61096680-61096702 CCTGTCAGGGGGTGGGGGCAAGG + Intergenic
1139217359 16:65139798-65139820 CCTAGCAAGGTATGGGGGAAAGG - Intergenic
1139352296 16:66344478-66344500 CCTAGCAAGGCTGGGGGGAATGG - Intergenic
1139594418 16:67949761-67949783 CAGGGCAGGGGGATGGGGAAAGG - Intronic
1140408198 16:74724945-74724967 GCTGGCAGCCGGAGGGGGAAGGG - Intronic
1140437163 16:74956900-74956922 CCTAGCTGGGGGATTGGGAAAGG - Intronic
1140442540 16:74998969-74998991 CCCGGCGGGGGGAGGGGGAGGGG + Intronic
1140775204 16:78243045-78243067 GCTAGGATGGGGAGAGGGAAGGG - Intronic
1140920531 16:79533542-79533564 GACGGCAGGGGGAGGGGGAATGG + Intergenic
1140926954 16:79592323-79592345 CCTAGCGGGGGTAGGGGACAGGG - Intronic
1141138572 16:81482614-81482636 CCTAGGTGGGGGAGGGGCAGGGG - Intronic
1141193055 16:81838602-81838624 CCTGTCAGGGGGTGGGGGCAAGG + Intronic
1141342186 16:83213404-83213426 ACAAGGAGGGGGTGGGGGAATGG - Intronic
1141431392 16:83971995-83972017 CCCAGCCCGGGGAGGGGGAGAGG + Intronic
1141431398 16:83972001-83972023 CCGGGGAGGGGGAGAGGGAAGGG + Intronic
1141481012 16:84306974-84306996 CAAAGCAGGGAGAGGGGGAAGGG + Intronic
1141610263 16:85177165-85177187 CCTGGAAGCAGGAGGGGGAAGGG + Intronic
1141693916 16:85611313-85611335 GCTGGGAGGGGGAGGGGGAGGGG - Intergenic
1141702111 16:85647251-85647273 GGTAGCAGGGGGAGGGTGCAGGG - Intronic
1141764275 16:86048333-86048355 CCCGGAAGGGGGAGGGGGGAAGG + Intergenic
1142117807 16:88369214-88369236 CCCAGCGTGGGGTGGGGGAATGG - Intergenic
1203019675 16_KI270728v1_random:388704-388726 ACTTGAAGGGTGAGGGGGAACGG + Intergenic
1203038010 16_KI270728v1_random:661862-661884 ACTTGAAGGGTGAGGGGGAACGG + Intergenic
1142710035 17:1717946-1717968 CCAAGCCTGGGGAGGAGGAATGG + Intronic
1143404793 17:6670143-6670165 CCTTGCTGGTGGAGGGTGAATGG - Intergenic
1143428118 17:6856435-6856457 CCAAGCTGGGGGAAGAGGAAAGG + Intergenic
1144585174 17:16483320-16483342 CCTAGCTGACGGAGGGTGAAAGG - Intronic
1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG + Intronic
1145265160 17:21376501-21376523 AGTAGCCGGGGGAGGGGGACTGG + Exonic
1145287468 17:21516958-21516980 CCTAGAAGGGGAAGGGGAAGGGG + Intergenic
1146305840 17:31729314-31729336 CCCAGCAGTGGGGGAGGGAAGGG - Intergenic
1146624506 17:34425161-34425183 CTTTGCAGGGGGAGGTGGTAGGG - Intergenic
1146659122 17:34652932-34652954 CCTATAAGGGGCAGGGGAAAGGG - Intergenic
1146767112 17:35533506-35533528 CCTGGCAGTTGGAGAGGGAATGG + Intronic
1147393549 17:40123580-40123602 CCTCTCAGGGGGAGGGGGAGGGG + Intronic
1147595055 17:41711727-41711749 CATGGTAGGGGGAGGGTGAAAGG + Intergenic
1147967257 17:44199906-44199928 CCGCGCAGAGGGAGGGGGAGAGG - Intronic
1148218661 17:45847698-45847720 TCTAGCTGGGGGAGGGGGAGGGG + Intergenic
1148722854 17:49767053-49767075 CCTAGCTGGAGGAGTGAGAAGGG + Intronic
1149246993 17:54720921-54720943 CCTATCAGGGGGTGGGGGAAGGG + Intergenic
1149621269 17:58047031-58047053 CAGAGCAGAGGGAGCGGGAAGGG - Intergenic
1150675586 17:67244570-67244592 CCGAGGAGGGGGCGGGGAAAGGG + Intronic
1151326829 17:73384916-73384938 CGTGGCAGAGGGAGGGGGCAGGG - Intronic
1151538276 17:74750584-74750606 ATTGGCAAGGGGAGGGGGAAGGG + Intronic
1151734156 17:75928364-75928386 GTAAGCAGGGGGAGGTGGAATGG + Intronic
1151829438 17:76540918-76540940 CAGAGGAGGAGGAGGGGGAAGGG - Intronic
1152373019 17:79902242-79902264 CCTAGCAGGGAAGGGGAGAATGG - Intergenic
1152595659 17:81236468-81236490 CCCAGCGGAGGGAGGGGGCAGGG + Intronic
1152940614 17:83170887-83170909 CTCAGCCGGGGGAGGGGGAAAGG - Intergenic
1153449524 18:5211726-5211748 TCTAGCTGGGGGCCGGGGAAGGG - Intergenic
1153571828 18:6481350-6481372 GGTAGGATGGGGAGGGGGAAGGG - Intergenic
1153748941 18:8209816-8209838 CCTGTCAGGGTGAGGGGTAAGGG + Intronic
1154243499 18:12674332-12674354 CCTGGGAGGGTGAGGTGGAAGGG + Intronic
1155543337 18:26888812-26888834 CCTAGCATCCGGAGGGGGAGAGG + Intergenic
1155685003 18:28537892-28537914 GCTAGTTTGGGGAGGGGGAAAGG - Intergenic
1156457281 18:37301914-37301936 TAGAGCAGGGGGAAGGGGAAAGG - Intronic
1156475929 18:37405328-37405350 ACTAGCAGAGGAAGGGGCAAGGG - Intronic
1156592664 18:38509231-38509253 CCAAGCAGGAGGATGGGGGATGG + Intergenic
1157220663 18:45826600-45826622 CCTAGGATGGGGATGGGGTAAGG - Intronic
1157544631 18:48539260-48539282 CCGAGTCGGGGGTGGGGGAAGGG - Exonic
1157609662 18:48948743-48948765 CCGAGGACGGGGAGGGGGCATGG - Intronic
1158119807 18:54036609-54036631 CATGGCAGGGTGAGGGGCAAAGG - Intergenic
1158495506 18:57951766-57951788 CCTAGGGGGGTGATGGGGAAAGG - Intergenic
1158505787 18:58044761-58044783 GCCGGCAGGGGGAGGGGAAAGGG + Intronic
1158811915 18:61047533-61047555 CATAACATGGGGAGGGTGAAAGG + Intergenic
1159092158 18:63861345-63861367 CCCTGCTGGGGGATGGGGAAGGG + Intergenic
1159146363 18:64458699-64458721 CCTGTCAGGGGTCGGGGGAAAGG + Intergenic
1160754722 19:751348-751370 CCTAGCGGGGGCAGAGGGAAAGG - Intronic
1161041521 19:2113141-2113163 CCAAGCAGGGGCCAGGGGAAGGG - Intronic
1161245556 19:3249741-3249763 CCTATCAGAGGGAGAGGGGATGG - Intronic
1161513773 19:4685377-4685399 GTCAGCAGGCGGAGGGGGAAGGG + Intronic
1161821562 19:6533606-6533628 CTTTGGAGGGGGAGGGGGAAGGG - Intronic
1161821623 19:6533748-6533770 CTCTGGAGGGGGAGGGGGAAGGG - Intronic
1162030331 19:7914502-7914524 CCTGGCAGGGCGAGGTGGGAAGG + Intergenic
1162070439 19:8149352-8149374 GCCGGCAGGGGGAGGGGGAGAGG - Intronic
1162160195 19:8708206-8708228 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
1162405160 19:10468801-10468823 ACTAGCTGGGGGAGAGGGAGAGG - Exonic
1162569961 19:11465999-11466021 CCTAGCTGGGGTGGGGGCAATGG - Intronic
1162583694 19:11546283-11546305 CCCAGCAGGAGGAGGGTGACGGG - Intronic
1162786003 19:13035314-13035336 CCAACCAGGGGGAGGTGAAAGGG - Intronic
1163286604 19:16352342-16352364 CCGAGGAGGAGGAGGAGGAAGGG - Intergenic
1163551303 19:17967531-17967553 CCTGGGAGGGGGAGGGTGCAGGG + Intronic
1165006820 19:32814210-32814232 CGTGGGAGGGGGCGGGGGAAAGG + Intronic
1165352712 19:35284879-35284901 CTTAGCATGGGGAGGGAGCAGGG - Intronic
1165742459 19:38211958-38211980 TCCCGCAGGGGGAGGGGGAGAGG - Exonic
1165774237 19:38395530-38395552 CCTGGCAGGGGCAGGGGGCCTGG + Exonic
1166354232 19:42217529-42217551 CCTTGCAGGGCGAGGGGGTCGGG - Intronic
1166361216 19:42253760-42253782 CCGAGCAGGGGGATGGGGATGGG + Intronic
1166428142 19:42697961-42697983 CCAAGCGGGCGGAGGGCGAAAGG + Intronic
1166678614 19:44754385-44754407 CCTCGAATGGGGCGGGGGAAGGG - Intronic
1166974888 19:46600259-46600281 CCTAAACGGGGGAGGGGGCAGGG + Intronic
1167121532 19:47520257-47520279 CCTGGCAGGGGCAGGGGCAGGGG - Intergenic
1167250903 19:48398007-48398029 CACAGCAGAGGGAGGTGGAAGGG - Intronic
1167381098 19:49138452-49138474 CCTAGTAGGGGGATGGGGAGAGG + Intronic
1167622125 19:50566405-50566427 CTGGGAAGGGGGAGGGGGAAGGG - Intronic
1167674496 19:50875956-50875978 AGTAGCAGGGGGAGGAGGAGAGG - Intronic
1167701181 19:51046988-51047010 CCCAGAAGGGGGAGGAGGGAGGG + Intergenic
1168412715 19:56149633-56149655 CCTGTCGGGGGGTGGGGGAAGGG - Intronic
1168720088 19:58550042-58550064 CCTAGGATGGGAAAGGGGAAGGG + Intronic
925280758 2:2682965-2682987 GCTAGCGGGGGGAAGGTGAAGGG + Intergenic
925342955 2:3149457-3149479 CCTAGCAGGGGCAGGGGCTGGGG - Intergenic
925862082 2:8188700-8188722 CAGACCAGGAGGAGGGGGAATGG + Intergenic
926127433 2:10280208-10280230 CCCAGCTGTGGGAGTGGGAAGGG - Intergenic
926191710 2:10733154-10733176 CCTATCAGGGGGAAGGAAAATGG + Intronic
926296562 2:11573148-11573170 CCTTGCAGGGGCTGGGGGAGTGG + Intronic
926628906 2:15119163-15119185 CTGAGCAGGGAGAGAGGGAAGGG + Intergenic
926847111 2:17153672-17153694 CCTATCATGGGGTGGGGGGAGGG + Intergenic
927718937 2:25370879-25370901 CAAAGGTGGGGGAGGGGGAAGGG - Intergenic
927889710 2:26740735-26740757 CCTAGCAGGCTGAGGGTAAATGG + Intergenic
928261131 2:29767749-29767771 CCAGGCAGGGGGAGGAGGCAGGG - Intronic
928549386 2:32356844-32356866 CCTCGCGGGGGCAGGGGGAGGGG - Intergenic
929813696 2:45213683-45213705 GGTAGTAGGGGGAAGGGGAAGGG - Intergenic
930017435 2:46980656-46980678 CCTGGCTGGGGCAGGGGAAATGG + Intronic
931028731 2:58145772-58145794 CCTGTCATGGGGTGGGGGAAGGG - Intronic
931155353 2:59622277-59622299 CCTTGCAGGGGTAGTGGGGAGGG + Intergenic
931348850 2:61470874-61470896 CCCCGCAGCGGGAGGGGGAGAGG + Intergenic
931880500 2:66564863-66564885 AATTACAGGGGGAGGGGGAAGGG - Intronic
932134246 2:69214542-69214564 CCTAGCTGGGGGAGGAAGGAAGG - Intronic
932247679 2:70209207-70209229 CCTAGGAGGGGGAGGTTGCAGGG + Intronic
932308205 2:70718868-70718890 CCTGGTAGGAGGTGGGGGAATGG + Intronic
932510527 2:72283656-72283678 CTCAGCAGGGAGAGGGGTAAAGG + Intronic
932759944 2:74432666-74432688 CCTAGCCAGGGTTGGGGGAAGGG + Exonic
933148447 2:78885477-78885499 CTTGGAAGGGGGAGGGTGAAAGG + Intergenic
933507634 2:83199151-83199173 CCTGCCAGGGGGTGGGGGAACGG - Intergenic
933736034 2:85495145-85495167 CTTAGGTGGGGGATGGGGAAGGG - Intergenic
934312301 2:91878353-91878375 ACTTGAAGGGTGAGGGGGAACGG + Intergenic
934713848 2:96531990-96532012 GCTAGCAGGGGTAGGGGGAGCGG - Intergenic
934943089 2:98516463-98516485 CCCTGCAGGGAGAGGTGGAAAGG + Intronic
935506970 2:103917404-103917426 TCCACCAGGGGGAGGGGAAAAGG - Intergenic
935829183 2:106982253-106982275 GTTAGGAGAGGGAGGGGGAAGGG - Intergenic
936070271 2:109365170-109365192 TCTGGCAGGGGGAGGGGAAGAGG - Intronic
936516615 2:113185277-113185299 CCAGGCAGGGAGAAGGGGAAAGG - Intronic
937337441 2:121070637-121070659 CCTGGCAGGGGGTGGGGGCAAGG - Intergenic
937457212 2:122052842-122052864 CCTGTCAGGTGGTGGGGGAAAGG - Intergenic
937509994 2:122584419-122584441 CCTGTCATGGGGTGGGGGAAGGG + Intergenic
937542406 2:122974218-122974240 TGTGGGAGGGGGAGGGGGAAGGG - Intergenic
937943719 2:127311633-127311655 CCTAGAGAGGGGAGGGGGAGTGG - Intronic
938059645 2:128242272-128242294 TCTAGCAGGAGGAGGGGAAAAGG + Intronic
938536449 2:132252995-132253017 GGCCGCAGGGGGAGGGGGAAGGG + Intronic
938597757 2:132805924-132805946 CCTGGCAGGAAGAGTGGGAAGGG - Intronic
938618212 2:133021361-133021383 CTTAGCAGGGGGAGTGGAATGGG + Intronic
938921652 2:136000671-136000693 CATGGCAGAGGGAGGGAGAAGGG + Intergenic
939931539 2:148240267-148240289 TGAGGCAGGGGGAGGGGGAAGGG + Intronic
940116960 2:150219794-150219816 CTTTGAAGGGTGAGGGGGAATGG + Intergenic
940859994 2:158761541-158761563 GCTGGGATGGGGAGGGGGAATGG + Intergenic
941064365 2:160884186-160884208 CCTGGCAGGGGCGGGGGGTACGG + Intergenic
941180808 2:162256908-162256930 ATTGGCAGTGGGAGGGGGAATGG - Intergenic
941334002 2:164217589-164217611 CCTAGAAGAGTGAGGTGGAATGG - Intergenic
942066000 2:172271992-172272014 CCTATCAGGGGTTGGGGGAGAGG - Intergenic
942431833 2:175920289-175920311 CCTGTCATGGGGTGGGGGAAGGG + Intergenic
942811613 2:180006852-180006874 CCAAGCAGGTGGGGAGGGAATGG - Exonic
942935733 2:181554554-181554576 ATTAAAAGGGGGAGGGGGAATGG - Intronic
943608459 2:190004123-190004145 CTTAGAATGGGGAGGGGGGAGGG + Intronic
944765325 2:202858464-202858486 CCTGTCAGGGGTTGGGGGAAAGG + Intronic
945296896 2:208179511-208179533 CCATGCAGTGGGAGGGGGGAAGG - Intronic
945460605 2:210103313-210103335 CCTGTCATGGGGTGGGGGAAGGG + Intronic
945627425 2:212228092-212228114 CCAAGGAGGGGGAGGTGAAAAGG - Intronic
945689720 2:213018521-213018543 CCTACCTGGGGCAGGGGGTATGG - Intronic
946127438 2:217575783-217575805 GCTAGGAAGGGGAGGGGGAAGGG + Intronic
946171788 2:217899974-217899996 GCTGGCAGGGGCCGGGGGAAGGG - Intronic
946258689 2:218467182-218467204 CTGGGCAGGGGGAGGGGGAAGGG - Intronic
946719613 2:222590358-222590380 CCTGTCATGGGGTGGGGGAAGGG + Intronic
947738907 2:232475913-232475935 CCTTGCAAGGGGAGCAGGAAGGG + Intergenic
948216122 2:236234227-236234249 CATAGCCAGGGGAGGGGGCAAGG - Intronic
948384450 2:237572926-237572948 CCTGGCAGGGGATGGGGGAGGGG - Intergenic
948605209 2:239130645-239130667 GCTTGCAGGCGGAGAGGGAAGGG - Intronic
948660102 2:239501729-239501751 TGTAACAGGGGGAGGGGCAAGGG + Intergenic
948884119 2:240874483-240874505 CCGGGCAGGGGGTAGGGGAAGGG + Intronic
948884795 2:240877249-240877271 CCTTGCAGGGGGAGGGGACTGGG - Intronic
948902028 2:240960910-240960932 GGCAGCAGGGGGAGGGGGAGGGG + Intronic
948945010 2:241215016-241215038 CCTTGCCTGGGGAGGGGGAGGGG + Intronic
1168987776 20:2064998-2065020 GATGGCAGGGAGAGGGGGAAAGG - Intergenic
1169137164 20:3204202-3204224 CCTAACAGGTGCAGAGGGAAAGG + Intronic
1169354687 20:4896909-4896931 CCCAGCAGGGGCAGGAGCAAAGG - Intronic
1169918307 20:10705894-10705916 CCAAGCAGGGGCAGGGGGTGAGG + Intergenic
1169942528 20:10952574-10952596 CATAGCAAGGGGAGGGGAAATGG - Intergenic
1170814260 20:19699310-19699332 CCTGGCGGGGAGAGGGGGAGAGG + Intronic
1171245798 20:23608661-23608683 CCAAGCAGGGGGAATGGGGAGGG - Intergenic
1171424877 20:25043057-25043079 CCTGGCAGGGGGAGGGGCCAGGG - Intronic
1172034841 20:32003257-32003279 CCCAGGAGGGGGAGGGGGAGGGG + Exonic
1172117989 20:32583324-32583346 CCGCGGAGGGGGAGGGGGAGGGG + Intronic
1172279090 20:33698137-33698159 CTTTGCAGGGGGCGGGGAAAGGG + Intergenic
1172455726 20:35071429-35071451 CCTGGCATGGGGTGGGGGGAGGG - Intronic
1173573171 20:44091360-44091382 CCAGGCAGGTGGAGTGGGAAGGG - Intergenic
1173686983 20:44930757-44930779 CCTTGCTGGGGCAGGGGGGAAGG - Intronic
1173807492 20:45935166-45935188 CCTCGCTGGGGTAGGGGGAGGGG + Intronic
1173907968 20:46642558-46642580 CTGAGCAGGGGGAGAGGGCAAGG - Intronic
1174415490 20:50363595-50363617 CCAAGCAGGGGCAGGTGGAGGGG + Intergenic
1174419652 20:50391252-50391274 CCTACCAGGGAGAGAGGGGAAGG - Intergenic
1174494438 20:50930362-50930384 CTTACCTGGGGGAGGGGGGACGG - Intronic
1174796145 20:53523975-53523997 CCTATCAGGGGGTGGGGGCAAGG + Intergenic
1174873251 20:54202826-54202848 CCTGTCAGGGGTAGGGGGCAAGG - Intergenic
1175199156 20:57266285-57266307 CCGAGCAGGGGGCGGGGGTCCGG - Exonic
1175200981 20:57277536-57277558 CCTAGGAGGAGCAGGGGGAGGGG + Intergenic
1175258611 20:57661594-57661616 CAAAGCCGGGGGAGGGGGATCGG + Intronic
1175414452 20:58792632-58792654 CCAGGCACGGGGAAGGGGAATGG + Intergenic
1175437416 20:58963324-58963346 CCTGGCAGAGGGACGGGAAAAGG + Intergenic
1175439284 20:58979610-58979632 CCTGGCTGGGGGCGGGGGAAGGG + Intergenic
1175904996 20:62375308-62375330 GCCAGGAGGGGGAGGGGGAGGGG + Intergenic
1176065040 20:63190100-63190122 AATATAAGGGGGAGGGGGAAGGG + Intergenic
1176275431 20:64263701-64263723 TCTAGGAGGAGGAGGGGGCATGG - Intronic
1176548774 21:8212869-8212891 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1176556669 21:8257078-8257100 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1176567705 21:8395904-8395926 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1176575608 21:8440120-8440142 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1176713245 21:10326628-10326650 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1177662596 21:24105497-24105519 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1178249718 21:30990776-30990798 CCCAGCAGGGGGAGCGGGGCTGG + Intergenic
1178521683 21:33292385-33292407 CCTAGCAGAAGTAGGAGGAAAGG - Intronic
1178858483 21:36269984-36270006 ATTATCAGGAGGAGGGGGAAAGG - Intronic
1179360930 21:40708093-40708115 CCTAGGATGGGGTAGGGGAAGGG + Intronic
1179460159 21:41529204-41529226 CCTAGAGCGGGGAGTGGGAATGG + Intronic
1179633058 21:42690631-42690653 CCTAACAGTGGCAGAGGGAATGG - Intronic
1179816033 21:43906934-43906956 CCTGGCAGGGGGAACAGGAAGGG + Intronic
1179994557 21:44967987-44968009 CTCAGCAGGGGGCGGGGGAGGGG - Intronic
1180037416 21:45256892-45256914 CCTACTTGGTGGAGGGGGAACGG - Intergenic
1180312063 22:11249650-11249672 GCCTGCGGGGGGAGGGGGAAGGG + Intergenic
1180515695 22:16140947-16140969 ACTGGGAGGGGGTGGGGGAATGG + Intergenic
1180634985 22:17257105-17257127 CTTAGCAGGGGGATTGGGAGTGG - Intergenic
1180687219 22:17678951-17678973 CCTACCTGGGTGTGGGGGAAGGG - Intronic
1180718662 22:17890341-17890363 CCTAGCAGGTGGGGGTGGAGGGG - Intronic
1180829628 22:18897210-18897232 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1181062354 22:20287659-20287681 CCTAGCAGGGTGTGTGAGAAGGG - Intergenic
1181274137 22:21677865-21677887 CACAGCAGGGGGAGGGGAGAGGG + Intronic
1181549760 22:23630962-23630984 CCTGTCAGGGGGCAGGGGAAGGG + Intronic
1181629177 22:24141586-24141608 CCTGGGAGGGGGTGGGGCAAGGG - Intronic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1182184161 22:28384720-28384742 CCTAGCAGTGGTAGTGGAAATGG - Intronic
1182331720 22:29555713-29555735 TCTAGCAGGGGGAGGGAGGCAGG + Exonic
1182593505 22:31399998-31400020 CCAAACACTGGGAGGGGGAACGG - Intronic
1182957552 22:34441427-34441449 CCTGCCAGGGGCTGGGGGAAAGG + Intergenic
1182986740 22:34725440-34725462 CCTGTCAGGGGGTCGGGGAAGGG + Intergenic
1183143357 22:35965953-35965975 CATGGCAGGGGGCGGGGGGATGG - Intronic
1183310560 22:37107329-37107351 CCCAGCAGGAGGAGGGGCAGTGG + Intronic
1183312640 22:37119122-37119144 GCAAGCAGGGGGTGGGGGCACGG + Intergenic
1183426724 22:37743762-37743784 ACAAGCATTGGGAGGGGGAAGGG + Intronic
1183619018 22:38961968-38961990 CCTAGGGGAGGGAGAGGGAAAGG + Intronic
1183624221 22:38991904-38991926 CCTAGGGGAGGGAGAGGGAAAGG + Intronic
1183639980 22:39086881-39086903 CCTAGGGGAGGGAGAGGGAAAGG + Intronic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1183716340 22:39535555-39535577 TCAAGCTGGGGGAGGGGGAGGGG + Intergenic
1183811241 22:40259586-40259608 CCCAGTAAGGGGAGGGGGAGTGG - Intronic
1184010676 22:41745667-41745689 CATAGTTGGGGGAGGGGGTAGGG + Intronic
1184272610 22:43393306-43393328 CCCAGCAGGGGAAAGGGGAGTGG - Intergenic
1184512452 22:44941624-44941646 GTTAGCAGGGGGATGGGGCAGGG + Intronic
1184635084 22:45821458-45821480 CCTAGCAGGGAGAGGAGGTTGGG - Intronic
1184662366 22:45971234-45971256 TAAAGGAGGGGGAGGGGGAAGGG + Intronic
1184690458 22:46115029-46115051 CCTGGCAGTGGGAGTGGGGAGGG - Intergenic
1184966166 22:47973744-47973766 TTTGGCAGGGGGTGGGGGAAGGG + Intergenic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190582 22:49433579-49433601 CCCAGCAGGGAGAGGGCGGATGG - Intronic
1203253659 22_KI270733v1_random:129174-129196 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1203261715 22_KI270733v1_random:174253-174275 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1203279719 22_KI270734v1_random:122482-122504 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
949846652 3:8377882-8377904 CCTGTCAGGGGGTGGGGGCAGGG + Intergenic
950127212 3:10517299-10517321 CCAGGCTGGGGGAAGGGGAAGGG - Intronic
950132510 3:10557087-10557109 CCTAGCCAGGAGAGGGAGAAGGG - Intronic
950720599 3:14879829-14879851 CCAGGTAGAGGGAGGGGGAAAGG + Intronic
950813607 3:15674456-15674478 TCTGGCAAGGGGAGTGGGAAAGG + Intronic
951542102 3:23791437-23791459 CCTTGAGGGGGGAGGCGGAAAGG + Intergenic
951631923 3:24731412-24731434 ACTAGATGGGGGAGGGAGAAAGG + Intergenic
952887726 3:38021876-38021898 GCTGGCTGGGGGAGGGGGTATGG - Intronic
953035822 3:39209903-39209925 ACTTGGAGGGGGTGGGGGAAGGG + Intergenic
953157286 3:40386828-40386850 CCTATGTGGGCGAGGGGGAAGGG - Intergenic
953619958 3:44524660-44524682 CCTGGCAGGGGGAGGTAAAATGG + Intergenic
953851457 3:46468459-46468481 CAGAGCAGGGTTAGGGGGAAGGG - Intronic
954114752 3:48460251-48460273 CCCAGCAGAGGGAGGCAGAAGGG + Exonic
954305441 3:49723110-49723132 CCCAGCTGGGGGAAGGGGACAGG + Exonic
954585991 3:51737338-51737360 CCTGTCAGGGGCAGGGGGGAAGG - Intergenic
954971711 3:54656798-54656820 TCTAACTGGGGAAGGGGGAAGGG - Intronic
955146448 3:56324887-56324909 CCAAGCAGAGGGAAGGGCAAAGG - Intronic
955294840 3:57725468-57725490 CTGGGAAGGGGGAGGGGGAATGG - Intergenic
955338479 3:58106658-58106680 CCTAGGGGGTGGAGGTGGAAGGG - Exonic
955352050 3:58200899-58200921 CCAGGGAGGGGGAGGAGGAAGGG - Intronic
955649013 3:61172966-61172988 CATTGCAGGTGGAGGGGTAAAGG - Intronic
956391903 3:68782733-68782755 CTAAGGAGAGGGAGGGGGAATGG + Intronic
956771787 3:72532844-72532866 CCTACCAGTAGGAGGGGGACAGG - Intergenic
957822587 3:85398154-85398176 CCTGTCATGGGGTGGGGGAAGGG - Intronic
958986473 3:100784875-100784897 CCCAGAAGGGGGAGGGTGAGAGG + Intronic
959321902 3:104887177-104887199 CATAGCAGGAGGAGGGTGGATGG + Intergenic
959572911 3:107904716-107904738 CTTTGAAGGGTGAGGGGGAATGG + Intergenic
959921637 3:111874578-111874600 CCTAGCAGGGGGGTGGGAAATGG + Intronic
960598947 3:119435972-119435994 ACTCTCAGGGGGAGAGGGAAAGG + Intronic
960865682 3:122197329-122197351 ACTAGTAGAGGGAGGTGGAAAGG - Intronic
961101956 3:124207255-124207277 CCTGGCAGGGGAAGGAGGGAAGG - Intronic
961350777 3:126300573-126300595 CAGAGCATGGGGACGGGGAAAGG - Intergenic
961487605 3:127227641-127227663 CCTGCCAGGTGGAGGGGGCAGGG + Intergenic
961721894 3:128902700-128902722 CCTGGAAGGGGCCGGGGGAATGG - Intronic
962824131 3:139083643-139083665 CATGGCAGGGGGTGGGGGTAGGG - Intronic
963232722 3:142925221-142925243 TCCAGCAGTGGGAGGGGAAAAGG - Intergenic
963580791 3:147124345-147124367 CCTGTCATGGGGTGGGGGAATGG - Intergenic
963907420 3:150784037-150784059 CCTGGCTGGGGGATGGGGAGTGG + Intergenic
963938865 3:151081432-151081454 AGTGGGAGGGGGAGGGGGAAGGG - Intergenic
964375266 3:156043071-156043093 CCTTGAAGGTGGAGGGTGAAAGG - Intronic
966086035 3:176067949-176067971 CCTGGCAGGGGGAGGTGAACAGG + Intergenic
967114579 3:186325235-186325257 ACTAGAGGGGGCAGGGGGAAGGG + Intronic
967931723 3:194694991-194695013 CCTACTAGGGAAAGGGGGAAGGG - Intergenic
968298638 3:197596517-197596539 CCTGGCAGGGGCAGGGGCAGGGG + Intergenic
968741018 4:2331819-2331841 ATTGGCAGGGGGAGGTGGAAGGG - Intronic
968925219 4:3543478-3543500 CCGAGGAGGGGCAGGGGGCAGGG - Intergenic
969021861 4:4144284-4144306 TCCAGCAGTGGGTGGGGGAAGGG - Intergenic
969053593 4:4388239-4388261 CCTGGCAGGGGCAGGCAGAAAGG - Intronic
969075867 4:4577250-4577272 CCTAGCATGGGGAGGAGGTGGGG - Intergenic
969252937 4:5981906-5981928 CCTAGCAGGGGTAGGTAGGAGGG + Intronic
969316644 4:6385517-6385539 CTTAACTGGGGGAGGGGGAAAGG - Intronic
969390477 4:6888694-6888716 CCTAGCCCTGGGAGGGAGAAGGG - Intergenic
969463006 4:7338655-7338677 CCTAGCTGAGGGATGGGGACAGG - Intronic
969543182 4:7806695-7806717 CCTTGCAGGGGAAAGGGGAGAGG - Intronic
969624956 4:8297670-8297692 CCAGGCAGTGGGAGTGGGAAGGG + Intronic
969732006 4:8963131-8963153 TCCAGCAGTGGGTGGGGGAAGGG + Intergenic
969853102 4:9977550-9977572 AGGAGCAGGGGGAGGGGGAGGGG - Intronic
970248109 4:14084856-14084878 CCCAGAAAGGGGAGGGGGCATGG + Intergenic
970335529 4:15036708-15036730 GCCAGGAGGGGGAGTGGGAATGG + Intronic
971038815 4:22727185-22727207 ACTAGTACTGGGAGGGGGAAGGG + Intergenic
971927899 4:33037840-33037862 CTTTGAAGGGTGAGGGGGAACGG - Intergenic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
973874007 4:55195958-55195980 CCTGTCAGGGGGTGGGGGGAAGG + Intergenic
973964675 4:56149231-56149253 CCTAGCAGGAGGATGGGGGAGGG - Intergenic
976007350 4:80445517-80445539 CCTGTCAGGGGTTGGGGGAAAGG + Intronic
976849566 4:89529670-89529692 CCTACCAGAAGAAGGGGGAAGGG - Intergenic
976883204 4:89955518-89955540 CGTGGCTGGGGGAGGTGGAAGGG + Intergenic
977785895 4:101034495-101034517 TCTAGCTGGGGGAGGGGGTGGGG - Intronic
977809750 4:101346178-101346200 CCTTCCAGGGGGAGGGGGAGGGG + Intronic
978530155 4:109704092-109704114 CCCAGGAGGGGGAGAGAGAAGGG - Intergenic
978734546 4:112070534-112070556 CCTATCATGGGGTGGGGGGAGGG + Intergenic
979800216 4:124898854-124898876 CCTATCATGGGGTGGGGGTAGGG + Intergenic
979915507 4:126428007-126428029 CCCAGCAGGGGGTGAGGTAATGG + Intergenic
979928035 4:126592312-126592334 TCCAGCAGAGGGAGGGGAAAAGG + Intergenic
979976817 4:127207277-127207299 CCTATCAAGGGGTGGGGGCAAGG - Intergenic
980011388 4:127598627-127598649 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
980065578 4:128184735-128184757 ACTAGAATGGGTAGGGGGAAGGG - Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
980558205 4:134437288-134437310 CCTATCAGGGGGTGGGGGGTTGG - Intergenic
980613288 4:135185343-135185365 TCTCGCAGGTGGCGGGGGAAGGG - Intergenic
980743060 4:136976562-136976584 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
981447515 4:144857103-144857125 ACTAGAATGGGGAGGGGGAAGGG + Intergenic
981686250 4:147458126-147458148 CCTGTCAGGGGGTGGGGGCAAGG + Intergenic
982391053 4:154864085-154864107 GTTAGCGGGGCGAGGGGGAATGG + Intergenic
982477511 4:155871996-155872018 CTTTGAAGGGTGAGGGGGAATGG + Intronic
983457364 4:167982170-167982192 CCTGTCAGGGGGTGGGGGGAGGG - Intergenic
983668847 4:170213099-170213121 CCTGTCATGGGGTGGGGGAAAGG + Intergenic
983681150 4:170354933-170354955 CCTGTCATGGGGTGGGGGAAAGG - Intergenic
984064580 4:175032712-175032734 CCCAGCAGGGTGAGTGGGCACGG - Intergenic
984636461 4:182115687-182115709 CCAAGCAGTGGCTGGGGGAAAGG - Intergenic
985313779 4:188632369-188632391 TCCAGCAGGGGGTGGGGAAAAGG + Intergenic
985940806 5:3134157-3134179 CCCAGCAGGGGGAGGGAAAAAGG - Intergenic
986461067 5:7972893-7972915 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
986557874 5:9029320-9029342 GCAACTAGGGGGAGGGGGAAAGG + Intergenic
986608968 5:9547776-9547798 CCAAGCAAGGGAAGGGAGAACGG - Intergenic
988352561 5:30130537-30130559 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
988612284 5:32738285-32738307 CCTATCAGGGGGTGGGGGGCAGG - Intronic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
988907851 5:35808397-35808419 CCTGTCATGGGGTGGGGGAAGGG - Intronic
989196174 5:38718778-38718800 CCCAGGAGGGGCAGGGGAAAGGG - Intergenic
989463702 5:41729762-41729784 CCTGTCATGGGGTGGGGGAAGGG + Intergenic
989813274 5:45704320-45704342 CCTGTCAGGGGGTGGGGGGAAGG - Intergenic
990589749 5:57249967-57249989 AGGAGGAGGGGGAGGGGGAAGGG - Intronic
990624361 5:57594742-57594764 CCTGTCAGGGGGTGGGGGTAAGG + Intergenic
990729058 5:58788351-58788373 CCTGGCAGGAGTAGGGGGCAAGG - Intronic
991576636 5:68111089-68111111 CCTAGTGGGAGGAGGAGGAAGGG - Intergenic
991581313 5:68157908-68157930 CCTGTCAGGGGTGGGGGGAAAGG + Intergenic
991974735 5:72174933-72174955 CCAAAGAGGGGAAGGGGGAAGGG - Intronic
992803360 5:80313340-80313362 CCTCTCATGGGGTGGGGGAAGGG - Intergenic
992814751 5:80425442-80425464 CCTAGCATGGGGACTAGGAAGGG - Intronic
993022043 5:82603737-82603759 TCTGGCAGGGGGAGGGGAAAAGG + Intergenic
993026052 5:82648198-82648220 CATACCAGGGCGAGGGGCAAGGG - Intergenic
993170968 5:84418732-84418754 CCTGTCATGGGGAGGGGGGAAGG - Intergenic
993171698 5:84428514-84428536 CCTGTCAGGGGGTGGGGGACTGG - Intergenic
993435039 5:87882726-87882748 CCTGTCATGGGGTGGGGGAAGGG - Intergenic
993905000 5:93612612-93612634 CCAAGGAAGGGGAGAGGGAAGGG + Intergenic
994274832 5:97822877-97822899 GCTGCCAGGGGGATGGGGAAGGG + Intergenic
994452402 5:99959060-99959082 CCTGTCAGGGGGTGGGGGACTGG - Intergenic
994541302 5:101101650-101101672 AGGAGGAGGGGGAGGGGGAAGGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996308013 5:122073023-122073045 CATAGCAATTGGAGGGGGAAAGG - Intronic
996937727 5:128967229-128967251 CAAGGCAGGGGGAGGAGGAAGGG - Intronic
997601762 5:135143714-135143736 CCTATCAGGGGTGGGGGGCAAGG - Intronic
998059620 5:139109726-139109748 TCTAGCAGTTGGATGGGGAAAGG - Intronic
999051971 5:148532513-148532535 TCTAGCAGAGGGATGGGGAAAGG + Intronic
999523937 5:152382059-152382081 CCTGTCAGGGGGATGGGGCAGGG - Intergenic
999745784 5:154590752-154590774 CAAAGGAGGGGGAGGGGGAGGGG - Intergenic
999858934 5:155624454-155624476 AGTAGCTGGGGGAGGAGGAAAGG + Intergenic
999917337 5:156277278-156277300 AATAGCAGGGAGAGAGGGAAAGG - Intronic
1000210687 5:159104236-159104258 CCTGGCAGGTGGCGAGGGAAGGG - Intergenic
1000397351 5:160789819-160789841 CCCAGCAGGGGGTTGGGGATGGG + Intronic
1000522653 5:162317526-162317548 CCAAGCAGAGAGAGGGGAAAAGG - Intergenic
1000823463 5:166014353-166014375 CCTAGCAGAGGGAGTGGCAAAGG + Intergenic
1000913976 5:167057784-167057806 TCTGGCAGGGGAAGGAGGAAAGG - Intergenic
1000984136 5:167848831-167848853 CGTAGCAGGGGGTTGGGAAAGGG - Intronic
1001180677 5:169517165-169517187 CCTGTCAGGGGGTGGGGGGATGG - Intergenic
1001620917 5:173084524-173084546 ACTAGTACTGGGAGGGGGAAGGG + Intronic
1001640462 5:173240274-173240296 GCTAGCAGGGGGCTGGGGAGGGG - Intergenic
1001822549 5:174721246-174721268 GCTAGAAGGGGGCGGGGGAGGGG - Intergenic
1001935028 5:175697571-175697593 CCCAGCGGGGGAATGGGGAAGGG - Intergenic
1001963767 5:175896021-175896043 CTGAGCTGGGGGAGGGGGGAAGG - Intergenic
1002461429 5:179375843-179375865 CTCAGCAGGGGAGGGGGGAAGGG + Intergenic
1003118851 6:3303690-3303712 GCTAGGAAGGGTAGGGGGAAGGG + Intronic
1003292146 6:4788821-4788843 CCTAACAGGTGGGGTGGGAAGGG - Intronic
1003369449 6:5510334-5510356 CCCTGCAGGGAGAGGGCGAAGGG - Intronic
1003562706 6:7196042-7196064 GTGAGCAGGAGGAGGGGGAAGGG - Intronic
1003583482 6:7364053-7364075 CCCAGCAGTGGGAGCTGGAATGG - Intronic
1003755435 6:9114292-9114314 CCTATCAGGGGGTGGGGGACTGG - Intergenic
1003977367 6:11356737-11356759 TATACCAGGGGGAGGGGAAAGGG - Intronic
1004119668 6:12808821-12808843 AGGAGGAGGGGGAGGGGGAAGGG - Intronic
1004949220 6:20649716-20649738 CCTGTTAGGGGGTGGGGGAAGGG - Intronic
1004965345 6:20843321-20843343 ACTAGCAGGGGGAAAGGGCAGGG - Intronic
1005055185 6:21722521-21722543 CTTTGAAGGGTGAGGGGGAATGG + Intergenic
1005102958 6:22193277-22193299 CCTAGCAGGGGTGGGGGGAGCGG + Intergenic
1005128885 6:22480103-22480125 TCTAGCAGAGGGAGGGGAAAGGG + Intergenic
1005838089 6:29723149-29723171 CACAGGAGGGGGAGGGGGAGGGG + Intronic
1006576348 6:35049264-35049286 ACTAACAGGGGAAGGGGGGAAGG - Intronic
1006635357 6:35457695-35457717 GCTGGCTGGGGGAGGGGGACTGG + Intronic
1007239782 6:40416724-40416746 CCTAGCAGGAGAAGGAGGAAGGG - Intronic
1007390838 6:41548676-41548698 CGCAGCAGGGGGAGGGGGTGGGG - Intronic
1007745205 6:44039344-44039366 CCTGGCAGGGACAGGGGCAAGGG + Intergenic
1007958929 6:45941326-45941348 CCTAGCTGGTGCAGGAGGAAAGG - Intronic
1007987826 6:46224930-46224952 CCTGTCATGGGGTGGGGGAAGGG - Intronic
1008488273 6:52058426-52058448 CCAAGCAGGGGGATGAGGATTGG - Exonic
1008851913 6:56032732-56032754 TCCAGCAGAGGGAGGGGCAATGG - Intergenic
1009217726 6:60944306-60944328 CGGAGGAGGGGGAGGGGGAGGGG - Intergenic
1009268577 6:61589060-61589082 CCTGTCAGGGGGTGGGGGTAGGG + Intergenic
1009301408 6:62027618-62027640 CCTAGGAGTGGGAGGGGCAAGGG + Intronic
1011210586 6:84952077-84952099 CCTATGAGGTGGAAGGGGAATGG + Intergenic
1011269604 6:85563919-85563941 CCTGTCATGGGGTGGGGGAAGGG - Intronic
1011362286 6:86540249-86540271 GAAAGCAGGGGGAGGGGGAGAGG + Intergenic
1011402331 6:86977180-86977202 CAGAGGAGGGAGAGGGGGAAGGG - Intronic
1012583095 6:100892427-100892449 CTTTGCAGGGTGAGGGGGAATGG - Intergenic
1012663034 6:101928393-101928415 CCTAACAGAGAGTGGGGGAAAGG - Exonic
1012758455 6:103263950-103263972 CTTAGCAGAGGGAGCTGGAAAGG - Intergenic
1013113793 6:107085405-107085427 TCTGGCAGGGGGAGGGGAAAGGG + Intronic
1013799223 6:113921478-113921500 CCTAGCAGGGGGAGCAGACAGGG - Intergenic
1014190771 6:118494319-118494341 TCTGGCAGGGGGAGGGGAAAAGG + Intronic
1014332329 6:120085510-120085532 CCTGTCATGGGGAGGGGGCAGGG - Intergenic
1014386167 6:120804972-120804994 CCTTGGAGGGGGTGGGGGAAGGG + Intergenic
1014648700 6:124008233-124008255 CCTGGCAGGCAGAGGAGGAAAGG - Intronic
1014953860 6:127592933-127592955 CTTTGAAGGGGGAGGGGGAATGG + Intergenic
1015139425 6:129912881-129912903 CCTGACAGGAGGAAGGGGAAAGG + Intergenic
1015184684 6:130401360-130401382 GCAAGCAGGGGGAGGGAGGAAGG - Intronic
1015228043 6:130880945-130880967 TCTGGCTGGGGGAGGGGGATTGG + Intronic
1015566759 6:134580830-134580852 CCTATCAGGGGTTGGGGGCAAGG + Intergenic
1015575349 6:134665428-134665450 GTTAGAAGGGGGAGGGGGAAGGG + Intergenic
1015779179 6:136846491-136846513 CCTGTCATGGGGTGGGGGAAGGG - Intronic
1015985625 6:138881478-138881500 CAGAGCAGGGGTGGGGGGAATGG + Intronic
1016101447 6:140106054-140106076 TCCAGCAGGGGGAGGGGAAAAGG - Intergenic
1016284265 6:142455008-142455030 CCTGTCAGGGGTAGGGGGAAAGG + Intergenic
1017002800 6:150007508-150007530 CGGGGTAGGGGGAGGGGGAAGGG - Intergenic
1017147025 6:151243691-151243713 CCAGGCGGGGGCAGGGGGAATGG + Intronic
1017659459 6:156659480-156659502 TCCAGCAGGGGGAGGAGAAAAGG + Intergenic
1018291467 6:162296209-162296231 CATAGAAGGGGGTGGGGGGATGG - Intronic
1018295771 6:162341750-162341772 CCTGTCAGGGGGTGGGGGGATGG + Intronic
1018753897 6:166831445-166831467 TCTGGCAGGGGCAGGGGGGAAGG - Intronic
1019007787 6:168816996-168817018 CCTTGCAGGGGGAGGAGGATAGG - Intergenic
1019525974 7:1480747-1480769 CCCAGCCTGGGGAGGGGGACGGG - Intronic
1019571425 7:1714300-1714322 CCGGGCAGGGGGAGCGGGCAGGG - Intronic
1019703819 7:2488081-2488103 CCTGGCTGGGGGCGGGGGAGAGG - Intergenic
1020309282 7:6856314-6856336 TCCAGCAGTGGGTGGGGGAAGGG - Intergenic
1020679523 7:11219807-11219829 CAAAGAAGTGGGAGGGGGAAAGG - Intergenic
1020717648 7:11696584-11696606 CCTGTCGGGGGGAGGGGGATAGG - Intronic
1021352012 7:19605613-19605635 CCTGGCTGGGGGTGGGGGATAGG - Intergenic
1021615318 7:22497933-22497955 CCAAGTAGGGGAAGGGGGATAGG + Intronic
1022108373 7:27213019-27213041 CCTAGCTGGGGGCGGGGTAGAGG + Intergenic
1022626820 7:32045196-32045218 CATGGCTGGGGGTGGGGGAAGGG - Intronic
1023412681 7:39903238-39903260 TCTGGCAGTGGGAGGGGAAAAGG + Intergenic
1023553809 7:41399068-41399090 TCTTGCAGGGGAAGGGGAAAAGG - Intergenic
1024470436 7:49764285-49764307 TCCAGCAAGGGGAGGGGAAAAGG + Intergenic
1025251294 7:57353238-57353260 CCTACCAGGGAGAGAGGGGAAGG + Intergenic
1025990165 7:66491552-66491574 CCCGGCAGGGGGCGGGGGAGGGG + Intergenic
1026738065 7:72961319-72961341 CCAGGCAGGGGCAGAGGGAAGGG + Intronic
1026789102 7:73320116-73320138 CCAGGCAGGGGCAGAGGGAAGGG + Intronic
1027105669 7:75403749-75403771 CCAGGCAGGGGCAGAGGGAAGGG - Intronic
1027266450 7:76497607-76497629 CCGAGCGGGGGCAGGGAGAAGGG - Intronic
1027317831 7:76995725-76995747 CCGAGCGGGGGCAGGGAGAAGGG - Intergenic
1027951495 7:84822652-84822674 CATAGAAAGGGGAGGAGGAATGG - Intergenic
1028241560 7:88427230-88427252 CCTATCATGGGGTGGGGGGAGGG + Intergenic
1028373049 7:90116232-90116254 CCTGTCATGGGGTGGGGGAAGGG + Intergenic
1028377175 7:90156699-90156721 CCAAGTAGGGGAAGGGGGATAGG - Intronic
1028427984 7:90712306-90712328 ATTACCAGGGGCAGGGGGAAGGG - Intronic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1029456886 7:100676071-100676093 GTAAGCAAGGGGAGGGGGAAGGG - Intronic
1029938164 7:104450566-104450588 CCTGACAGGGGGTGGGGGACTGG + Intronic
1030032661 7:105383949-105383971 CAACGCAGGGGGAAGGGGAATGG + Intronic
1030743827 7:113141033-113141055 CATGACAGGGGAAGGGGGAATGG + Intergenic
1031532064 7:122886938-122886960 TCCAGCAGGTGGAGGTGGAATGG + Intergenic
1032053715 7:128667722-128667744 CTTAGGACGGGGAGGGGGCAGGG - Intergenic
1032062568 7:128737339-128737361 CCTAGCAAGGGAAAGGGAAATGG - Intergenic
1032290780 7:130588646-130588668 TGGGGCAGGGGGAGGGGGAAGGG + Intronic
1033217174 7:139501503-139501525 TCTAGATGGGGGAGGGAGAAGGG + Intergenic
1033454117 7:141487029-141487051 ACAAGCAGAGGGAGGAGGAATGG + Intergenic
1033473290 7:141667838-141667860 CCTGGCATGGGGTAGGGGAATGG - Intronic
1033704771 7:143876114-143876136 CCAACCAGGGGGAGGATGAAAGG - Exonic
1033875050 7:145805629-145805651 CATTCCGGGGGGAGGGGGAAGGG - Intergenic
1033991039 7:147287343-147287365 CAGAGCAGGGGGAGTAGGAATGG + Intronic
1034527728 7:151676237-151676259 CTGAGGAGGGGGAGGGGGAGGGG + Intronic
1034821192 7:154217822-154217844 CCCAGGAGGGAGAGAGGGAAGGG + Intronic
1034880904 7:154761842-154761864 CCTGTCATGGGGTGGGGGAAGGG - Intronic
1034895745 7:154875379-154875401 CCGAGCAGAGGGAGGGAGAAAGG + Intronic
1034959448 7:155355904-155355926 CCTGTCAGGAGGAGGGGCAAGGG - Intergenic
1034975644 7:155448085-155448107 CCCTGCAGGTGGAGGGGGAAAGG + Intergenic
1035235678 7:157496409-157496431 TCCAACAGGGGAAGGGGGAAGGG + Intergenic
1035385689 7:158471264-158471286 CATAGGAGGGGGAGGCGGGAGGG - Intronic
1035412744 7:158658190-158658212 CCTACCACAGGGAGAGGGAAGGG + Intronic
1035665972 8:1379836-1379858 CCGAGCAGGAGGGGAGGGAAGGG - Intergenic
1035665990 8:1379886-1379908 CCGAGCAGGAGGGGAGGGAAGGG - Intergenic
1035666009 8:1379934-1379956 CCGAGCAGGAGGGGAGGGAAGGG - Intergenic
1036830085 8:12014534-12014556 CCTAGCAGGGGAAGGGGCGGGGG - Intronic
1037120967 8:15286624-15286646 CCTGTCAGGGGGCAGGGGAAGGG - Intergenic
1037798278 8:22015330-22015352 CATAGCAGGGGGTGGGGCAGGGG + Intergenic
1037829675 8:22180080-22180102 CCTAGGAGAGGGAGGTGGCACGG + Intronic
1038008367 8:23453639-23453661 GCTAACAGGGGAAGGGGAAAAGG + Intronic
1038472584 8:27837890-27837912 CCTGGGAGAGGGAGGAGGAACGG - Exonic
1038484744 8:27926440-27926462 CCTGTCAGGGGGTGGGGGACTGG + Intronic
1038485144 8:27929716-27929738 CCAAGCAGGCGGAGCAGGAAAGG + Intronic
1038776104 8:30532254-30532276 CCTACCAGAGGGAGGTGGCAGGG - Intronic
1041361925 8:57064004-57064026 CCAAGCAGGGGCAGGGGAAATGG + Intergenic
1041720033 8:60967432-60967454 CTTGGCAGAGGGAAGGGGAACGG + Intergenic
1041823149 8:62062747-62062769 GCTGCCAGGGGGTGGGGGAAGGG - Intergenic
1042055860 8:64764241-64764263 TATTGCAGGGGGCGGGGGAAGGG - Intronic
1042132583 8:65602254-65602276 CATATCAGGGGGTGGGGGGAAGG + Intergenic
1042176527 8:66042703-66042725 GCGAGGAGGGGGAGGGGGGAGGG - Intronic
1042206164 8:66331939-66331961 ACCACCAGGGGAAGGGGGAACGG + Intergenic
1042466182 8:69132242-69132264 CCTGCCAGAGGGTGGGGGAAAGG + Intergenic
1042828472 8:73001980-73002002 CATAGAAAGGGGAGGGGGCATGG - Intergenic
1042868278 8:73374881-73374903 ACTAGTAGAGGGAGGAGGAAGGG + Intergenic
1042956480 8:74256385-74256407 CCTATCATGGGGTGGGGGGAAGG + Intronic
1043026647 8:75078884-75078906 CCTAAGAGAGGGAGGGGGAGGGG + Intergenic
1043393334 8:79812290-79812312 CCTGGAAGGGAGAAGGGGAAGGG + Intergenic
1043511475 8:80954362-80954384 CCTGTCAGGGGGTGGGGGAAAGG + Intergenic
1043629491 8:82311288-82311310 CCTGTCCTGGGGAGGGGGAAGGG - Intergenic
1043712667 8:83441682-83441704 ACTACCAGAGGGAGGAGGAAAGG - Intergenic
1044932024 8:97260140-97260162 AGGAGGAGGGGGAGGGGGAAGGG + Intergenic
1045562921 8:103283313-103283335 CCTAGCAGTGGGCGGGGGGTGGG - Intergenic
1045963970 8:108001880-108001902 TCTGGCAGGGGGTGGGGGCAAGG + Intronic
1046537227 8:115530923-115530945 CCTGTCATGGGGTGGGGGAAGGG + Intronic
1047128221 8:121987311-121987333 CTTTGAAGGGTGAGGGGGAATGG + Intergenic
1047293653 8:123551930-123551952 CCTGTCATGGGGTGGGGGAAGGG + Intergenic
1047434743 8:124826973-124826995 CATACTAAGGGGAGGGGGAAAGG - Intergenic
1047453138 8:124984793-124984815 CATAGCAGGGGTAGAGGGGAGGG - Intergenic
1047486361 8:125334557-125334579 TCCAGCAGGGGGAGGTGGGAAGG - Intronic
1047886825 8:129260547-129260569 TCTGGCAGGGGGAGGGGAAAAGG - Intergenic
1048007654 8:130432067-130432089 AGGAGGAGGGGGAGGGGGAAGGG + Intronic
1048469064 8:134691181-134691203 CCTAGCATGGTGAGGGAAAAGGG - Intronic
1048600707 8:135916277-135916299 CGGGGGAGGGGGAGGGGGAAGGG - Intergenic
1048608659 8:135997615-135997637 TCCAGCAGGGGGAGAGGAAAAGG + Intergenic
1048767767 8:137863008-137863030 CCTGGTGGGGGGAGGGGGAAAGG - Intergenic
1048961156 8:139579440-139579462 CCTGGCAGGGGGTAGTGGAAGGG - Intergenic
1049016527 8:139924017-139924039 CCGAGCACGGGGAGGGGGCATGG + Intronic
1049059428 8:140264590-140264612 GAGAGGAGGGGGAGGGGGAAGGG + Intronic
1049199736 8:141334185-141334207 CCTGGCAGGGTGGAGGGGAACGG + Intergenic
1049253191 8:141600193-141600215 CCTAGAGGCTGGAGGGGGAAGGG + Intergenic
1049325265 8:142018245-142018267 ACAAGCAGCGGGAGGGGGGACGG - Intergenic
1049326047 8:142022148-142022170 CCTTGCAGGTGGAGGGGTCAGGG - Intergenic
1050602441 9:7266588-7266610 ACTGGCTGGGGCAGGGGGAATGG - Intergenic
1051302821 9:15671506-15671528 CCTGGCAGGGGGTGGGGGGCTGG - Intronic
1051499947 9:17765629-17765651 CCTAGCAAGGTGTTGGGGAAAGG - Intronic
1051548244 9:18300454-18300476 CCTGTCAGGGGGAGGGGGGCTGG + Intergenic
1052478182 9:28988779-28988801 CCTACCTGGGGGAGTGGGACTGG + Intergenic
1052480440 9:29018298-29018320 ACTAGCTGGGGGAGGGAGAAAGG + Intergenic
1052745351 9:32434902-32434924 CCTAACAAGGGGAAGGGGAGAGG + Intronic
1052799714 9:32956189-32956211 CCTGGGTGGGGGAGGGGGAAAGG - Intergenic
1053000618 9:34575424-34575446 CTTAGCAGGGGGGTGGGGTAAGG + Intronic
1053049695 9:34949842-34949864 CCTCTCGGGGGTAGGGGGAAAGG + Intergenic
1053347364 9:37387722-37387744 CCCACCAGGGGGAGAGGGAATGG + Intergenic
1053367064 9:37530445-37530467 GATAGCAGGTGGAGGGGGAAGGG - Intronic
1053570647 9:39301958-39301980 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1053800109 9:41758660-41758682 CCGAGGAGGGGCAGGGGGCAGGG - Intergenic
1053836597 9:42142875-42142897 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1054092269 9:60860975-60860997 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1054113682 9:61136568-61136590 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1054126498 9:61317054-61317076 TCTGGCAGGAGGAAGGGGAAAGG - Intergenic
1054188537 9:61970812-61970834 CCGAGGAGGGGCAGGGGGCAGGG - Intergenic
1054464779 9:65487132-65487154 CCGAGGAGGGGCAGGGGGCAGGG + Intergenic
1054594012 9:67045619-67045641 TCTGGCAGGAGGAAGGGGAAAGG - Intergenic
1054649984 9:67617805-67617827 CCGAGGAGGGGCAGGGGGCAGGG + Intergenic
1054690413 9:68317883-68317905 AATAGCCGGGGGGGGGGGAAGGG + Intergenic
1055020113 9:71660397-71660419 TACTGCAGGGGGAGGGGGAAGGG + Intergenic
1055838498 9:80474003-80474025 CCTAGCAGTGGCATGGGGAAGGG + Intergenic
1056978637 9:91285303-91285325 CCTGTCATGGGGTGGGGGAAGGG + Intronic
1057342417 9:94214558-94214580 CTTTGAAGGGTGAGGGGGAATGG - Intergenic
1057993515 9:99797996-99798018 CCAACAAGGGGGAGGGGGGAGGG + Intergenic
1058139512 9:101342528-101342550 AGTGGGAGGGGGAGGGGGAAGGG + Intergenic
1058491121 9:105500595-105500617 CACAGCAGGGGGAGGAGAAAAGG - Intronic
1060183083 9:121547192-121547214 CAAAGGAGGGGGAGGGGGAGGGG - Intergenic
1060278059 9:122197278-122197300 GGTAGGAGGGGGAGAGGGAAAGG - Intronic
1060319027 9:122538151-122538173 CCAGGCAGGGGCAGGGGGACTGG - Intergenic
1060420362 9:123464568-123464590 AGTAGCTGGGGCAGGGGGAAGGG + Intronic
1060630834 9:125157120-125157142 ACTGGTAGGGGGAGGGGGGAGGG - Intronic
1061089571 9:128419412-128419434 CCCAGCGGTGGGAGGGTGAAGGG + Intronic
1061310118 9:129756534-129756556 CCTTGCAGAGGGTGGGGGACAGG + Intergenic
1061637469 9:131922016-131922038 CCTGTCATGGGGAGGGGGGAGGG + Intronic
1061745548 9:132736957-132736979 GCTTCCAGGGGCAGGGGGAAGGG + Intronic
1062022904 9:134327423-134327445 CCGAGAAGGGGGAGAGGGCATGG + Intronic
1062029564 9:134356129-134356151 CCTGGCAGGGGCAGGAGGGAAGG - Intronic
1062074731 9:134579751-134579773 AGGAGGAGGGGGAGGGGGAAGGG + Intergenic
1062380376 9:136284109-136284131 CCCAGCAGGAGGAGAGGGGAGGG + Intronic
1062481420 9:136754225-136754247 CCTAGCAGGGCGGGAGGGCAGGG + Intergenic
1062648671 9:137564364-137564386 CCCAGCAGAGCGAGGGGGCAGGG + Intronic
1203768187 EBV:37242-37264 CAGAGCAGGGGGAGGGGCAGGGG + Intergenic
1203470059 Un_GL000220v1:112322-112344 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1203477880 Un_GL000220v1:156294-156316 GCCCGCGGGGGGAGGGGGAAGGG - Intergenic
1185575623 X:1169991-1170013 ACAACCAGGGGGAGGGGGGAAGG - Intergenic
1186250141 X:7656829-7656851 CATGGCAGGGGATGGGGGAAGGG + Intergenic
1186347892 X:8713261-8713283 CCAAGCTGGGGGATGGAGAATGG + Intronic
1186425621 X:9463201-9463223 ACCAGCAGGCGGTGGGGGAAGGG + Intergenic
1186515230 X:10161768-10161790 TCTAGCAAGGGGTGGGGGAGAGG + Intronic
1186736140 X:12466114-12466136 CCTAGCTGGAAGAGGTGGAAAGG + Intronic
1186974160 X:14882005-14882027 CCTGGCATGGGGTGGGGGAAGGG + Intronic
1188526893 X:31097071-31097093 ACTAGACGGGGGAGAGGGAAGGG + Intergenic
1188792763 X:34424473-34424495 CGGGGTAGGGGGAGGGGGAAGGG - Intergenic
1188976685 X:36683805-36683827 CCTAGCTAGGGAATGGGGAATGG + Intergenic
1189267227 X:39726100-39726122 CCCAGCAGCAGCAGGGGGAAAGG - Intergenic
1189422733 X:40870977-40870999 ACTAGAAGGGGGAGGGGAAAAGG - Intergenic
1189446646 X:41086247-41086269 CCGGGCCGGAGGAGGGGGAACGG - Intronic
1189599662 X:42609564-42609586 CCTGTCAGGGGATGGGGGAAGGG + Intergenic
1189762786 X:44339749-44339771 GCAAGCAGGGGAGGGGGGAAGGG + Intronic
1190307368 X:49092421-49092443 CCAAGCAGGTGGTGGGGGCAGGG - Intronic
1190334328 X:49253255-49253277 CCTTGTAGGGGGAGGGGACAGGG - Intronic
1190448801 X:50557434-50557456 CCCAACAGGGGAAGTGGGAAAGG + Intergenic
1191025311 X:55907913-55907935 ACTAGAATGGGGAAGGGGAAGGG - Intergenic
1191714688 X:64186183-64186205 CCTATCATGGGGGGAGGGAACGG + Exonic
1191767346 X:64712673-64712695 TGGGGCAGGGGGAGGGGGAAGGG - Intergenic
1192069187 X:67918722-67918744 CCAAGCTGGGGAAGTGGGAAAGG - Intergenic
1192188465 X:68974878-68974900 TCCAGCAGTGGGAGGGGAAAAGG - Intergenic
1192291708 X:69803809-69803831 GCTGGGAAGGGGAGGGGGAAGGG - Intronic
1192456832 X:71283286-71283308 CCAAGTGGTGGGAGGGGGAAAGG - Intronic
1192973856 X:76261932-76261954 CCTCTCAGGGGGTGGGGGATAGG - Intergenic
1194344385 X:92745200-92745222 CCTACCAGGGGGTGGGGAATGGG - Intergenic
1195660823 X:107376195-107376217 CCTGTCAGGGGGTGGGGGGAGGG - Intergenic
1195794476 X:108629811-108629833 CCTGTCATGGGGTGGGGGAATGG - Intronic
1196304213 X:114082558-114082580 CCTATCATGGGGTGGGGGAGGGG - Intergenic
1197449318 X:126592473-126592495 CCTGTCAGGGGTGGGGGGAAAGG - Intergenic
1197761251 X:130030033-130030055 TCTGGGAGGGGGAAGGGGAAAGG - Intronic
1197830674 X:130639124-130639146 TCTGGCAGGGGAAGGGGAAAAGG + Intronic
1197876763 X:131116621-131116643 CATAGCTGGGGCAGGGGGATGGG + Intergenic
1197925010 X:131637043-131637065 CCTGTCAGGGGGTGGGGGCAAGG - Intergenic
1198117269 X:133556291-133556313 GCTAGGAGGGGGAGGTGAAAGGG - Intronic
1198134422 X:133733280-133733302 CTCAGAAGGGGGAGGGTGAAAGG + Intronic
1198748464 X:139914662-139914684 CTTAGCTGAGGGAAGGGGAAGGG - Intronic
1199175310 X:144781324-144781346 CCTATCATGGGGTGGGGGGAGGG + Intergenic
1199494806 X:148441269-148441291 CCCAGCAGGGGGATAGGGAATGG - Intergenic
1199793219 X:151174312-151174334 CCAAGCAGGGGTAGGGGCCAGGG + Intergenic
1199966502 X:152824892-152824914 GGGAGCAGGGGTAGGGGGAAGGG - Intergenic
1200364503 X:155647454-155647476 CCTGTCAGGGGGTGGGGGCAAGG - Intronic
1200652730 Y:5861841-5861863 CCTACCAGGGGGTGGGGAATGGG - Intergenic
1200829150 Y:7673446-7673468 TCTGGCAGGGGGAGGGCGGAGGG - Intergenic
1201180268 Y:11335845-11335867 ACTTGAAGGGTGAGGGGGAATGG + Intergenic
1201417911 Y:13766364-13766386 CCAAGCTGGGGGATGGAGAATGG - Intergenic
1202390893 Y:24369441-24369463 CTTAGCAGGGGTAGGGGGACGGG + Intergenic
1202479891 Y:25300675-25300697 CTTAGCAGGGGTAGGGGGACGGG - Intergenic