ID: 914425712

View in Genome Browser
Species Human (GRCh38)
Location 1:147573668-147573690
Sequence TGCTCCCCATTTTAGAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2861
Summary {0: 1, 1: 1, 2: 41, 3: 402, 4: 2416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914425712_914425714 -6 Left 914425712 1:147573668-147573690 CCTTATCTCTAAAATGGGGAGCA 0: 1
1: 1
2: 41
3: 402
4: 2416
Right 914425714 1:147573685-147573707 GGAGCATTGCTGTAAAGGTTAGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914425712 Original CRISPR TGCTCCCCATTTTAGAGATA AGG (reversed) Intronic
Too many off-targets to display for this crispr