ID: 914429638

View in Genome Browser
Species Human (GRCh38)
Location 1:147609199-147609221
Sequence CAACTGTTTAACCACCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914429638_914429641 15 Left 914429638 1:147609199-147609221 CCTTAAAGGTGGTTAAACAGTTG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 914429641 1:147609237-147609259 AAGAGCCTAATTTTATTCTTTGG 0: 1
1: 0
2: 3
3: 42
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914429638 Original CRISPR CAACTGTTTAACCACCTTTA AGG (reversed) Intronic
900939439 1:5788650-5788672 CAAGTGTTTACCCAACTTAACGG + Intergenic
910510292 1:87996170-87996192 CGACTGTATAACAACCTTTTTGG + Intergenic
914429638 1:147609199-147609221 CAACTGTTTAACCACCTTTAAGG - Intronic
916181410 1:162087049-162087071 CAAAAGTTCAACCACCTTTTGGG - Intronic
916587381 1:166160166-166160188 CAACTGTGTGACCATCTCTATGG + Intronic
916777941 1:167988711-167988733 CAACTGGTTAACATGCTTTAGGG + Intronic
917699565 1:177566615-177566637 CCATTGTTTAACCACCTATGAGG - Intergenic
921465378 1:215481145-215481167 CAACTATTTCATCACCTTGAAGG + Intergenic
1065302294 10:24333779-24333801 CAACCTTTTAACCATCTTTATGG - Intronic
1070113728 10:73509193-73509215 CAACTGTATAAAGACATTTATGG + Intronic
1071613880 10:87056772-87056794 CAACTGTTTCACCACATATATGG + Intronic
1072011722 10:91307679-91307701 CAAGTGTTTGAACAGCTTTAGGG + Intergenic
1074259983 10:111843167-111843189 CAAATGGTTAACCAGCTGTATGG + Intergenic
1075174423 10:120145978-120146000 CACCTGTTTAACCAGCATGAAGG + Intergenic
1076106861 10:127830391-127830413 CAACAGTTTTACAAACTTTAAGG - Intergenic
1079193703 11:18304857-18304879 CAGCAGTTTAACAACTTTTAGGG + Intronic
1080285249 11:30603828-30603850 GAACTGTTCAAATACCTTTATGG - Intergenic
1083188713 11:61034363-61034385 CAACTTTTTAAAAACCTTTTTGG - Intergenic
1090497739 11:127231100-127231122 CAACTGTATAACCATATATATGG + Intergenic
1091326894 11:134697893-134697915 CATCTGTGTAACCACCCTCAAGG + Intergenic
1095681542 12:44982019-44982041 CAACTGCTCAACCACTTTTGGGG - Intergenic
1095842024 12:46703735-46703757 CAACTGTATCATCAACTTTATGG - Intergenic
1096164764 12:49413050-49413072 CAACTGTTTAACAACGTGTCTGG - Intronic
1098918406 12:76280409-76280431 CAACTGTTTGATCACCCATAGGG + Intergenic
1099748961 12:86746270-86746292 CCTCTGTTTAAAAACCTTTAGGG + Intronic
1102064258 12:109959957-109959979 CAATTATTTTCCCACCTTTAGGG - Exonic
1102618825 12:114177416-114177438 CACCTGTTTTACAACCTTTGGGG + Intergenic
1103034915 12:117648733-117648755 AAAATATTTAACCACCCTTATGG + Intronic
1108327357 13:49347370-49347392 CAAATGTTTAAAAACCTTTGGGG + Intronic
1126228168 15:46295514-46295536 CAACTCTCTAACCTCCTTTTAGG + Intergenic
1126570183 15:50142372-50142394 CAACTGTATAATCACCATCAAGG + Intronic
1127723572 15:61726021-61726043 TGAGTGTTTAACCACCTTGAGGG - Intergenic
1127979299 15:64022870-64022892 CATCTGTCTAACCCCCTTTGAGG - Intronic
1129080966 15:73040517-73040539 CAATTGTATTACCACCTTTGAGG - Intergenic
1133126002 16:3646404-3646426 CACCTGTTTACCCTCGTTTATGG - Intronic
1137245956 16:46705172-46705194 CAACAGTTTCACTACCTTTCAGG - Intergenic
1137777709 16:51070370-51070392 CAAGCTTTTAACCACCTCTAAGG - Intergenic
1139499843 16:67353741-67353763 CACCTGTAGAACCACCTTCAAGG - Intronic
1142436169 16:90059052-90059074 CATCTCTTTAACCACATTTGTGG - Intronic
1145097951 17:20047858-20047880 CATCTTTTTAATCACTTTTATGG + Intronic
1146891885 17:36511631-36511653 CAACTTTTCAACAACCTGTAAGG + Intronic
1149836128 17:59914684-59914706 CACCTTTTTAAGCACCTTCATGG - Exonic
1150661228 17:67081472-67081494 CAACTATTCCACCATCTTTAAGG + Intronic
1150702512 17:67460234-67460256 AAACTGCTTAGCCACCTCTAAGG - Intronic
1155982672 18:32196920-32196942 CACCTGTTTAACCAAGTGTAGGG - Intronic
1156359253 18:36369841-36369863 TCACTGTATAACCACCTCTAGGG - Intronic
1156907265 18:42369001-42369023 CACCTGATTAACCACCTTCCAGG + Intergenic
1157351577 18:46892206-46892228 CAACTGTTTAAAACCCTATATGG + Intronic
1158038388 18:53063106-53063128 CAACTGTTTAACTGCATTTGGGG + Intronic
1159344312 18:67179611-67179633 TAACTGTTTAACACACTTTAAGG - Intergenic
1160962319 19:1728378-1728400 CAACTCCGTAACCACCTTAAAGG + Intergenic
1165464271 19:35963391-35963413 CAAGCTTTTAACCACCTTTTTGG + Intergenic
925219437 2:2126122-2126144 CAACTGTTCCACCAGCTTCAGGG + Intronic
928298080 2:30102623-30102645 CAACTGTTCCACCACTGTTAAGG - Intergenic
928670140 2:33594796-33594818 CACCTGTTAACCCACCCTTATGG - Intronic
930243542 2:48960150-48960172 TACCTGTATAATCACCTTTAGGG + Intergenic
930311209 2:49742286-49742308 CCACTGTTTAAACACATTAATGG + Intergenic
930327289 2:49935896-49935918 GAAATATTTAACCACCTTGAAGG - Intronic
932937037 2:76115562-76115584 CAACAGTTTAAACATCTGTAAGG + Intergenic
933039285 2:77441850-77441872 AAACTGTTTAAGGACATTTAAGG + Intronic
934051289 2:88213395-88213417 CAACTGTTTCATCACCTTAGGGG + Intergenic
936035189 2:109105490-109105512 CACCTGTTTGACCACCTTCCAGG + Intergenic
939631978 2:144536587-144536609 AAACTGTTTAACCAACTTCCAGG - Intergenic
940579997 2:155566024-155566046 CAACTTTTTAACAATCTTTCAGG - Intergenic
940842716 2:158602700-158602722 AAACTGTTTAACAGCCTTTTTGG + Intronic
943327332 2:186516946-186516968 AAACTTTTTAAACAGCTTTAAGG + Intergenic
943550628 2:189335153-189335175 CAACTGTTTGACTACCCTCAAGG - Intergenic
947105016 2:226660387-226660409 CAAATGTTTAACCAAATTTCTGG + Intergenic
948358084 2:237396420-237396442 CAAATGTTTTACCACCTGAAGGG - Intronic
1170583777 20:17718706-17718728 CAAATGTTTGACATCCTTTAAGG - Intronic
1174712717 20:52724431-52724453 CAACTTGTTCATCACCTTTAAGG + Intergenic
1178377949 21:32083785-32083807 AAAATATTTAACCACTTTTATGG + Intergenic
1179073026 21:38090634-38090656 CACCTGTTTGACTAACTTTAAGG - Intronic
950864836 3:16180852-16180874 CAACTGTTTAATCACAGCTATGG - Intronic
951365111 3:21771565-21771587 CAACTGTTCGAGCATCTTTAAGG - Intronic
957617927 3:82555714-82555736 CAAATGCTTAACCCCCTTTATGG + Intergenic
961941466 3:130641827-130641849 CCACTTTTTTCCCACCTTTATGG + Intronic
964656686 3:159074736-159074758 CAACTGTAGAAACACCTTTTTGG + Intronic
964950628 3:162287784-162287806 CAACTGTTTTACCAACCCTATGG - Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966421508 3:179739069-179739091 CAACTGTTATACCACCCTCAGGG + Intronic
966578989 3:181537889-181537911 CAAGTGTCTAACTACCTTTTAGG + Intergenic
967471230 3:189864439-189864461 TAACTGTTCAACCTCCTTGAAGG + Intronic
970103950 4:12558967-12558989 CCACTGTTTAAAAAACTTTAAGG + Intergenic
974589801 4:63930699-63930721 CAAGTGTCTAATCACTTTTAAGG + Intergenic
975370797 4:73584807-73584829 CAAGTTTTTAACCACCATGATGG - Intronic
979013616 4:115402566-115402588 CAAATGTATAACCACCATTGAGG + Intergenic
979086666 4:116419932-116419954 CTACTGGTAAACCACCTGTATGG + Intergenic
979174431 4:117645373-117645395 CAACTGTGTTAACAACTTTATGG - Intergenic
980581373 4:134757658-134757680 CAAATGGTTAACCACCTCTCTGG + Intergenic
981171357 4:141627350-141627372 AAACTGTTTTACCCTCTTTAAGG - Intergenic
981979901 4:150778646-150778668 CAACTTTTTTGTCACCTTTATGG - Intronic
984218663 4:176945921-176945943 CACCTCTTTAACCTCCATTATGG - Intergenic
984963956 4:185125338-185125360 CTACTCTTTAGCCACCTTGATGG - Intergenic
987453525 5:18115717-18115739 CATCTGTTTAACCACTATAAAGG - Intergenic
991402582 5:66269427-66269449 CAGCTGTTTAAATATCTTTAAGG - Intergenic
993701034 5:91119674-91119696 CAACTTTGTAGCCAACTTTAGGG + Intronic
995530352 5:113085988-113086010 CCACTGGATAACTACCTTTAAGG + Intronic
998568142 5:143234106-143234128 CAACAGTTTAGCCCCCTTCAGGG - Intergenic
999012102 5:148054571-148054593 CAACTGGTTAACAAACTTTCAGG - Intronic
1004196261 6:13508401-13508423 CATCTGTGTAACCACCTTCCGGG + Intergenic
1007794917 6:44339559-44339581 CAACTGTTTCTCCAGCTTTAGGG - Intronic
1010935464 6:81855629-81855651 CCACTGTTTAACCACACTTTGGG - Intergenic
1012416012 6:99014675-99014697 CAACTGATTAAATACCTCTAAGG - Intergenic
1014632642 6:123804594-123804616 CCTCTGTTTAACAACCTGTACGG - Intronic
1014992057 6:128093058-128093080 CCATTGTTTCACCACCATTATGG - Intronic
1023221828 7:37927316-37927338 CATCAGTTTAAACACCTGTATGG - Intronic
1030176306 7:106659502-106659524 CAACTGTTTAAACATTTTCAAGG - Exonic
1032727446 7:134603991-134604013 CTAATGTTTAAACACCTCTAGGG + Intergenic
1033012541 7:137637540-137637562 CAACTGCTAAACCAACTTGAAGG + Intronic
1034841959 7:154406587-154406609 TAACAGTTCAACCACATTTATGG + Intronic
1035770073 8:2139935-2139957 GAGCATTTTAACCACCTTTAAGG + Intronic
1039907155 8:41795002-41795024 GGTCTGTTTAACAACCTTTACGG - Intronic
1040775725 8:51041043-51041065 CAAATTTTTAACCTCCATTATGG - Intergenic
1044388972 8:91626330-91626352 CAAGTGATTGACCACATTTACGG + Intergenic
1045962779 8:107988193-107988215 CAACTATTTAAAAACGTTTAAGG - Intronic
1046738263 8:117800792-117800814 AAAATATTTAACCAACTTTAGGG - Intronic
1046910890 8:119625333-119625355 CAACCATTTAACCACTTTTTTGG - Intronic
1059920215 9:119151933-119151955 CAACTGTTTAACCATTCTCAAGG + Intergenic
1060824666 9:126681084-126681106 CAACTGGTTTCCCACCTTTGGGG - Intronic
1187109603 X:16283120-16283142 CAACTTTTTAAACACCATGATGG - Intergenic
1187563451 X:20424566-20424588 CAACTGTTTAATTATCTGTATGG - Intergenic
1196516570 X:116620015-116620037 TAAGTGTTTAAGCACTTTTAAGG - Intergenic
1199535926 X:148903301-148903323 AAACTGTTTAAGCACCTGGAGGG - Intronic