ID: 914430649

View in Genome Browser
Species Human (GRCh38)
Location 1:147618226-147618248
Sequence GCCTCCTGGAAACTCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914430646_914430649 -10 Left 914430646 1:147618213-147618235 CCAGAGATGTCAGGCCTCCTGGA 0: 1
1: 0
2: 0
3: 25
4: 210
Right 914430649 1:147618226-147618248 GCCTCCTGGAAACTCCAGGAGGG No data
914430642_914430649 7 Left 914430642 1:147618196-147618218 CCAACCAAAAACGGAAACCAGAG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 914430649 1:147618226-147618248 GCCTCCTGGAAACTCCAGGAGGG No data
914430643_914430649 3 Left 914430643 1:147618200-147618222 CCAAAAACGGAAACCAGAGATGT No data
Right 914430649 1:147618226-147618248 GCCTCCTGGAAACTCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914430649 Original CRISPR GCCTCCTGGAAACTCCAGGA GGG Intronic
No off target data available for this crispr