ID: 914433703 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:147641615-147641637 |
| Sequence | GCCTTGACTCCTTTCTCTAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 196 | |||
| Summary | {0: 1, 1: 1, 2: 2, 3: 17, 4: 175} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914433703_914433708 | -9 | Left | 914433703 | 1:147641615-147641637 | CCCTTAGAGAAAGGAGTCAAGGC | 0: 1 1: 1 2: 2 3: 17 4: 175 |
||
| Right | 914433708 | 1:147641629-147641651 | AGTCAAGGCAGGGACAGGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914433703 | Original CRISPR | GCCTTGACTCCTTTCTCTAA GGG (reversed) | Intronic | ||