ID: 914433703

View in Genome Browser
Species Human (GRCh38)
Location 1:147641615-147641637
Sequence GCCTTGACTCCTTTCTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914433703_914433708 -9 Left 914433703 1:147641615-147641637 CCCTTAGAGAAAGGAGTCAAGGC 0: 1
1: 1
2: 2
3: 17
4: 175
Right 914433708 1:147641629-147641651 AGTCAAGGCAGGGACAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914433703 Original CRISPR GCCTTGACTCCTTTCTCTAA GGG (reversed) Intronic