ID: 914437974

View in Genome Browser
Species Human (GRCh38)
Location 1:147677196-147677218
Sequence ACAATTTGGGAATCACGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914437971_914437974 -5 Left 914437971 1:147677178-147677200 CCAGAGACACGTTTCATTACAAT No data
Right 914437974 1:147677196-147677218 ACAATTTGGGAATCACGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914437974 Original CRISPR ACAATTTGGGAATCACGTAT AGG Intergenic
No off target data available for this crispr