ID: 914442442

View in Genome Browser
Species Human (GRCh38)
Location 1:147719254-147719276
Sequence TTCAAACAATAGTGGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914442442_914442445 10 Left 914442442 1:147719254-147719276 CCTTGGAGCCACTATTGTTTGAA No data
Right 914442445 1:147719287-147719309 TGCCCTGCTGATGCTGTGCATGG No data
914442442_914442446 11 Left 914442442 1:147719254-147719276 CCTTGGAGCCACTATTGTTTGAA No data
Right 914442446 1:147719288-147719310 GCCCTGCTGATGCTGTGCATGGG No data
914442442_914442448 12 Left 914442442 1:147719254-147719276 CCTTGGAGCCACTATTGTTTGAA No data
Right 914442448 1:147719289-147719311 CCCTGCTGATGCTGTGCATGGGG No data
914442442_914442450 19 Left 914442442 1:147719254-147719276 CCTTGGAGCCACTATTGTTTGAA No data
Right 914442450 1:147719296-147719318 GATGCTGTGCATGGGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914442442 Original CRISPR TTCAAACAATAGTGGCTCCA AGG (reversed) Intergenic
No off target data available for this crispr