ID: 914444970

View in Genome Browser
Species Human (GRCh38)
Location 1:147742335-147742357
Sequence AACTGCCTGCTCCAATATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914444970_914444973 18 Left 914444970 1:147742335-147742357 CCCTCATATTGGAGCAGGCAGTT No data
Right 914444973 1:147742376-147742398 GCAAGATTTCATCATTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914444970 Original CRISPR AACTGCCTGCTCCAATATGA GGG (reversed) Intergenic
No off target data available for this crispr