ID: 914445129

View in Genome Browser
Species Human (GRCh38)
Location 1:147743829-147743851
Sequence AGTGCTAGACTGAGACCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914445122_914445129 19 Left 914445122 1:147743787-147743809 CCCTCCATGAAAAGGAATCCAAT No data
Right 914445129 1:147743829-147743851 AGTGCTAGACTGAGACCTCTAGG No data
914445124_914445129 15 Left 914445124 1:147743791-147743813 CCATGAAAAGGAATCCAATGTAA No data
Right 914445129 1:147743829-147743851 AGTGCTAGACTGAGACCTCTAGG No data
914445123_914445129 18 Left 914445123 1:147743788-147743810 CCTCCATGAAAAGGAATCCAATG No data
Right 914445129 1:147743829-147743851 AGTGCTAGACTGAGACCTCTAGG No data
914445120_914445129 21 Left 914445120 1:147743785-147743807 CCCCCTCCATGAAAAGGAATCCA No data
Right 914445129 1:147743829-147743851 AGTGCTAGACTGAGACCTCTAGG No data
914445126_914445129 1 Left 914445126 1:147743805-147743827 CCAATGTAATCAGCCTTCCAGGC No data
Right 914445129 1:147743829-147743851 AGTGCTAGACTGAGACCTCTAGG No data
914445121_914445129 20 Left 914445121 1:147743786-147743808 CCCCTCCATGAAAAGGAATCCAA No data
Right 914445129 1:147743829-147743851 AGTGCTAGACTGAGACCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914445129 Original CRISPR AGTGCTAGACTGAGACCTCT AGG Intergenic
No off target data available for this crispr