ID: 914447160

View in Genome Browser
Species Human (GRCh38)
Location 1:147759848-147759870
Sequence ATGTTTAAATGGCTGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914447156_914447160 -8 Left 914447156 1:147759833-147759855 CCACAACTGTTCCAAATGTTTAA No data
Right 914447160 1:147759848-147759870 ATGTTTAAATGGCTGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914447160 Original CRISPR ATGTTTAAATGGCTGTTGGA TGG Intronic
No off target data available for this crispr