ID: 914450032

View in Genome Browser
Species Human (GRCh38)
Location 1:147783119-147783141
Sequence GGATGCAACTATTTTCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914450032_914450035 2 Left 914450032 1:147783119-147783141 CCAAACTGAAAATAGTTGCATCC No data
Right 914450035 1:147783144-147783166 AAAGCTTCAATGTAAATTGGTGG No data
914450032_914450036 7 Left 914450032 1:147783119-147783141 CCAAACTGAAAATAGTTGCATCC No data
Right 914450036 1:147783149-147783171 TTCAATGTAAATTGGTGGTGTGG No data
914450032_914450037 14 Left 914450032 1:147783119-147783141 CCAAACTGAAAATAGTTGCATCC No data
Right 914450037 1:147783156-147783178 TAAATTGGTGGTGTGGAATTTGG No data
914450032_914450034 -1 Left 914450032 1:147783119-147783141 CCAAACTGAAAATAGTTGCATCC No data
Right 914450034 1:147783141-147783163 CTAAAAGCTTCAATGTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914450032 Original CRISPR GGATGCAACTATTTTCAGTT TGG (reversed) Intergenic
No off target data available for this crispr