ID: 914450614

View in Genome Browser
Species Human (GRCh38)
Location 1:147788173-147788195
Sequence GAGTCTGGAGTGTCTAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914450596_914450614 29 Left 914450596 1:147788121-147788143 CCTCCAGACCCCAGGCTCTACCC No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data
914450607_914450614 8 Left 914450607 1:147788142-147788164 CCTCAGGCCTGGGCAGTGGGATA No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data
914450600_914450614 20 Left 914450600 1:147788130-147788152 CCCAGGCTCTACCCTCAGGCCTG No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data
914450601_914450614 19 Left 914450601 1:147788131-147788153 CCAGGCTCTACCCTCAGGCCTGG No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data
914450606_914450614 9 Left 914450606 1:147788141-147788163 CCCTCAGGCCTGGGCAGTGGGAT No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data
914450599_914450614 21 Left 914450599 1:147788129-147788151 CCCCAGGCTCTACCCTCAGGCCT No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data
914450597_914450614 26 Left 914450597 1:147788124-147788146 CCAGACCCCAGGCTCTACCCTCA No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data
914450609_914450614 1 Left 914450609 1:147788149-147788171 CCTGGGCAGTGGGATAGGCTCCA No data
Right 914450614 1:147788173-147788195 GAGTCTGGAGTGTCTAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914450614 Original CRISPR GAGTCTGGAGTGTCTAGGGC TGG Intergenic
No off target data available for this crispr