ID: 914452228

View in Genome Browser
Species Human (GRCh38)
Location 1:147802782-147802804
Sequence GCTCAGTGCACAGCCTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914452228_914452234 25 Left 914452228 1:147802782-147802804 CCCAAGCAGGCTGTGCACTGAGC No data
Right 914452234 1:147802830-147802852 CTCATCCCAGCCAGGCACAGTGG No data
914452228_914452233 17 Left 914452228 1:147802782-147802804 CCCAAGCAGGCTGTGCACTGAGC No data
Right 914452233 1:147802822-147802844 AAATAAGACTCATCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914452228 Original CRISPR GCTCAGTGCACAGCCTGCTT GGG (reversed) Intergenic
No off target data available for this crispr