ID: 914456410

View in Genome Browser
Species Human (GRCh38)
Location 1:147841140-147841162
Sequence ACCCAGAGGGAGGCGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 1, 1: 0, 2: 11, 3: 82, 4: 708}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914456410_914456420 2 Left 914456410 1:147841140-147841162 CCTTCCCCCGCCTCCCTCTGGGT 0: 1
1: 0
2: 11
3: 82
4: 708
Right 914456420 1:147841165-147841187 CCTGATGAAGACACCTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914456410 Original CRISPR ACCCAGAGGGAGGCGGGGGA AGG (reversed) Intergenic
900365275 1:2309671-2309693 ACCCACAGGGAGGAGGAGGTGGG - Exonic
900365293 1:2309709-2309731 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900365313 1:2309747-2309769 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900365334 1:2309786-2309808 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900365357 1:2309827-2309849 ACCCACAGGGAGGAGGGGGTGGG - Exonic
900467980 1:2835070-2835092 AGCCAGAGGGAGTCGGGGGTCGG + Intergenic
900552672 1:3264532-3264554 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
900552733 1:3264686-3264708 GCCAGGAGGGAGGCAGGGGAGGG + Intronic
900577374 1:3389954-3389976 AGCCAGAGGGTGGGGGGGGGGGG - Intronic
901066509 1:6497113-6497135 AACCAGCGAGAGGCGGGGGGAGG + Intronic
901845620 1:11980404-11980426 CCCCAGGGGGAGGCGGGAGGAGG - Exonic
901930707 1:12595081-12595103 ACGCAGAGGGAGGGGAGGGGAGG + Intronic
901956973 1:12793406-12793428 TCCCAGAGGGAGGCAGGTGAAGG - Exonic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901969445 1:12895647-12895669 TCCCAGAGGGAGGCGGAGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901980369 1:13029542-13029564 TCCCAGAGGGAGGCAGGTGAAGG - Intronic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901989067 1:13097771-13097793 TCCCAGAGGGAGGCGGGTGAAGG + Intergenic
901992746 1:13128996-13129018 TCCCAGAGGGAGGCGGGTGAAGG - Intergenic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902001718 1:13199389-13199411 TCCCAGAGGGAGGCAGGTGAAGG + Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902007782 1:13246041-13246063 TCCCAGAGGGAGGTGGAGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902015727 1:13306133-13306155 TCCCAGAGGGAGGCGGAGGAAGG - Intronic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902018737 1:13328618-13328640 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
902020946 1:13345114-13345136 TCCCAGAGGGAGGCAGGTGAAGG + Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902026759 1:13389836-13389858 TCCCAGAGGGAGGCGGAGGAAGG - Exonic
902304732 1:15527101-15527123 TCTCGGAGGGCGGCGGGGGAGGG + Intronic
902916956 1:19644955-19644977 ACACGGAGGCAGGCGGGGAACGG - Intronic
903081681 1:20816310-20816332 TCCGGGAGGGAGGCGGGGGGGGG + Intronic
903480869 1:23652407-23652429 AGGGAGAGGGAGGAGGGGGAAGG + Intergenic
903485663 1:23688174-23688196 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
903637900 1:24833836-24833858 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
903857304 1:26344802-26344824 ACCCAGAAGGAGGTGGTGCAGGG - Exonic
903857342 1:26344955-26344977 ACCCAGAAGGAGGTGGTGCAGGG - Exonic
903857383 1:26345108-26345130 ACCCAGAAGGAGGTGGTGCAGGG - Exonic
903857425 1:26345261-26345283 ACCCAGAGGGAGGTCGTGAAGGG - Exonic
903894579 1:26595463-26595485 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
903962289 1:27064615-27064637 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
904748944 1:32728923-32728945 ACCCATGGGGATGCTGGGGAGGG + Intergenic
904784432 1:32974271-32974293 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
904857289 1:33509282-33509304 TCCCGGAGGGAGGTGGGGGGGGG - Intergenic
905467630 1:38167263-38167285 ATCCCAAGGGAGTCGGGGGAGGG + Intergenic
906135988 1:43501270-43501292 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
906345613 1:45012642-45012664 AACCAGAGGGACTGGGGGGAGGG - Intronic
906761510 1:48382634-48382656 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
907722163 1:56982266-56982288 AGCCAGAGGGATGGTGGGGAGGG - Intergenic
907796108 1:57719369-57719391 AGCCAGAGGGAGGTGGGTCAAGG + Intronic
908462350 1:64357595-64357617 ACCCTGGGGGCGGCGGGGGTGGG - Intergenic
909641105 1:77870224-77870246 ACCGGGAGGGAGGTGGGGGGGGG - Intronic
911121287 1:94299748-94299770 AGCCAGAGGGAGGAAGGGGAGGG + Intergenic
911614478 1:99993446-99993468 ACCGAGAGGGAGAAGGGAGAGGG - Intronic
911769671 1:101724384-101724406 AGACAGAGAGAAGCGGGGGAAGG + Intergenic
912389516 1:109292638-109292660 ACAGAGAGGGAGGTGAGGGAGGG + Intronic
912547422 1:110460942-110460964 ATCCAGAGGGAGGCCGGGGTGGG + Intergenic
912828535 1:112929249-112929271 CCCCAGATGGAGGCTGGGGCTGG - Exonic
913046535 1:115078132-115078154 AGCTAGGGGGAGGCGGAGGAGGG - Intronic
913047828 1:115089195-115089217 ACAAAGAGGGAGGGGAGGGATGG - Intronic
913174003 1:116257272-116257294 ACTCAGAGGGAGGGAGGGGCAGG - Intergenic
914456410 1:147841140-147841162 ACCCAGAGGGAGGCGGGGGAAGG - Intergenic
914888255 1:151600964-151600986 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
914919321 1:151837115-151837137 AGCCAGAAGGAGGTGGGGGTGGG - Intergenic
915172252 1:153986242-153986264 ACACCGGGGGAGCCGGGGGAGGG + Exonic
915335122 1:155136411-155136433 TACCAGAGGGAGGTGGGGGCGGG + Intronic
915916207 1:159942366-159942388 ACAGAGAGGGTGGCTGGGGAGGG - Intronic
915973559 1:160370675-160370697 TCCCAGAGGGAGGGGTGGGGAGG + Exonic
916269235 1:162921955-162921977 ACCCTGAGGAAGTTGGGGGATGG + Intergenic
916271178 1:162943386-162943408 ACCCTGTGGGAGCCGGGGGTGGG + Intergenic
916416683 1:164598853-164598875 ACCCGGAGGTAGGAAGGGGAGGG + Intronic
916964001 1:169916578-169916600 ACCCAGGATGAGGAGGGGGAGGG - Intergenic
917415470 1:174804601-174804623 ATCCCGAGGGAGGCCGGGCACGG - Intronic
918198808 1:182247737-182247759 ACCCAGAGGGAGTCAAAGGAAGG + Intergenic
918509156 1:185291314-185291336 ACCCTGAGGGAGGTGAAGGAGGG - Exonic
919467195 1:197936407-197936429 ATCCAGAAGGAGGCTGGGCATGG - Intergenic
920145964 1:203861420-203861442 ACCTGGAGGGAGGCGGGAGGAGG - Intergenic
920215992 1:204361864-204361886 TCCCAGAGGGAGGCCGGGGAGGG + Intronic
920262145 1:204695834-204695856 AGCCTGAGGGAGGCTGGGGCCGG + Intergenic
921140272 1:212299051-212299073 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
922102259 1:222486870-222486892 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
922102287 1:222486985-222487007 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
923236417 1:232037529-232037551 ACCCACAGTGAGGCTGTGGATGG + Intronic
923476755 1:234341046-234341068 ACCCTGAGGGAGGGGGGAAAGGG + Intergenic
924587830 1:245375454-245375476 AACCAGAGAGAGGAGGTGGAAGG + Intronic
924709734 1:246522366-246522388 ACCCAGAGGGAGCCAGGGTGAGG + Intergenic
924917669 1:248590320-248590342 AGCCATGGTGAGGCGGGGGATGG + Intergenic
1062897642 10:1116356-1116378 ACCCAGGGTGAGGTGGGTGACGG - Intronic
1063086062 10:2818532-2818554 ACTGAGAGGGAGGGAGGGGATGG + Intergenic
1063450176 10:6145508-6145530 ACCCGGAGGGCGGCGGGGCCCGG + Intronic
1063876480 10:10484196-10484218 AGACAGAGAGAGGAGGGGGAGGG - Intergenic
1064108334 10:12519397-12519419 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
1064998263 10:21315184-21315206 ACCCACGGGGAGGCAGGGGTGGG - Intergenic
1065189798 10:23198843-23198865 GGCCGGGGGGAGGCGGGGGAAGG + Intergenic
1067696211 10:48537396-48537418 ACCCATAGTGAGGCTGGAGAGGG - Intronic
1067748785 10:48956507-48956529 AAGCAGAGGGAGGAGGGTGAAGG - Intronic
1067828628 10:49597349-49597371 ACCCAGAGGGAGGGCAGGAAAGG - Intergenic
1069052874 10:63812473-63812495 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
1069403627 10:68075313-68075335 CACGCGAGGGAGGCGGGGGAGGG + Intronic
1069717286 10:70529394-70529416 GGCCAGAGGGAGGTGAGGGAGGG - Intronic
1069823622 10:71242242-71242264 ACCCAGGGGGAGGTGGGGCGAGG - Intronic
1070328362 10:75402014-75402036 AAAAAGAGGGAGGCGGCGGATGG - Intergenic
1070585756 10:77764725-77764747 CCCCAGAGGGAGGCTAGTGAGGG + Intergenic
1070696146 10:78564627-78564649 ACCCAGACAGAGGAGTGGGAGGG + Intergenic
1070767117 10:79063192-79063214 ACCCCGAGAGGGGTGGGGGAAGG - Intergenic
1070797237 10:79223826-79223848 TCCCTCAGGGAGGTGGGGGAGGG - Intronic
1070807809 10:79280798-79280820 ACACAGAGGGAGGTGGAGGCAGG - Intronic
1071457597 10:85862868-85862890 ACCCAGAGGGAGGAAATGGAGGG + Intronic
1071569691 10:86690231-86690253 ACCCACTGGGAGGGGAGGGAAGG - Intronic
1072602156 10:96941064-96941086 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
1072734394 10:97869260-97869282 ACCCAGAGGCAGCCCGGTGAAGG + Exonic
1073048835 10:100655184-100655206 AGACACAGCGAGGCGGGGGAGGG - Intergenic
1073552384 10:104415289-104415311 AGCCAGTGGGTGGAGGGGGAGGG + Intronic
1073611304 10:104946697-104946719 ACCCACAGGGAGGTGGGGAGAGG - Intronic
1075220553 10:120580946-120580968 TCCCAGACAGAGGCGGGGGTTGG - Intronic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076415064 10:130280211-130280233 ACCCAGGGTGGGGTGGGGGATGG - Intergenic
1076519817 10:131074532-131074554 ACCAAGAGGGAGGCAGGTGTGGG + Intergenic
1076570996 10:131432707-131432729 ACCCAGACAGAGGCTGAGGAGGG + Intergenic
1076615417 10:131751460-131751482 CCCCAGTGGGAGGCTGAGGAAGG - Intergenic
1077194963 11:1274854-1274876 ACACAGGCGGGGGCGGGGGAGGG + Exonic
1077308013 11:1876514-1876536 GCCCAGAGGGCGGCTGGAGAGGG - Intronic
1077800068 11:5528201-5528223 AGCCAGATGGAGGCAGGAGATGG - Intronic
1078086104 11:8233756-8233778 TCCCAGAGCCAGGCTGGGGAAGG - Intronic
1078176910 11:8978228-8978250 ACCGGGAGGGAGGTGGGGGGGGG + Intergenic
1079444966 11:20548857-20548879 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1081289269 11:41305263-41305285 TCCGGGAGGGAGGTGGGGGAGGG + Intronic
1081594948 11:44452717-44452739 CCCCAGTGGGAGGCAGGGGAGGG - Intergenic
1082001798 11:47397217-47397239 GGCCAGAGGGAGGCCAGGGAGGG - Intergenic
1082657670 11:55872842-55872864 ACCCAGAGGCCGGCGCGGAAGGG - Intergenic
1082825096 11:57571775-57571797 ACCCAGAGGAAGGGGGGGTGTGG - Intergenic
1082844970 11:57717712-57717734 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1083274250 11:61587892-61587914 GCCCAGAGGGAGGAGGGGGACGG + Intergenic
1083318856 11:61833001-61833023 ACCCAGAGTGGGGCAGGGGCAGG + Intronic
1083535949 11:63466789-63466811 GCCCAGAGGGAGGCGTGACATGG - Intronic
1083596618 11:63920775-63920797 CCCCAGTGGGCGGCAGGGGAGGG - Intergenic
1083678269 11:64340040-64340062 GCCCAGAGGTTGGCGGCGGAAGG - Intergenic
1083738813 11:64696965-64696987 ACCCAGAGAGAGCCTGGGGAAGG + Intronic
1083757095 11:64797473-64797495 ACACAGAGGGAGGCTGGAGCTGG - Intronic
1084002648 11:66305475-66305497 ACCCTGAGTGAGGATGGGGAAGG + Intergenic
1084169092 11:67391931-67391953 ACCAATGGGGAGGCGGGGGCGGG + Exonic
1084385968 11:68842791-68842813 ACCCAGGGGGTTGAGGGGGAGGG + Intronic
1084546917 11:69819249-69819271 CCCCAGGCGGAGGCGCGGGAGGG + Intergenic
1084556574 11:69879478-69879500 GCCCAGGGGGAGGTGGGGGTGGG + Intergenic
1084564585 11:69921794-69921816 ACCCCGAGGAAGGCTGGGGCAGG + Intergenic
1084582470 11:70032516-70032538 GAGCAGAGGGAGGCGGGAGAGGG + Intergenic
1085037050 11:73307122-73307144 ACTCAGACGGAGGCAGGGGCGGG + Intergenic
1085787032 11:79462093-79462115 ACCCAGAGGGATGTGGTGGCTGG + Intergenic
1085930736 11:81080056-81080078 AACCAGAGGGAGGAGGTAGAGGG - Intergenic
1086365872 11:86109810-86109832 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1086365900 11:86109925-86109947 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1087583944 11:100094296-100094318 ACCCAGTTGGAGGCAGGGGGAGG - Intronic
1087675277 11:101154479-101154501 ACCCAGAGGAAGGACTGGGAGGG + Intergenic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1088875866 11:113935803-113935825 GCCCAGCGGGAGGTTGGGGACGG + Intronic
1089257299 11:117200620-117200642 ACCCAGGAGGAGGAAGGGGAAGG + Intronic
1089574185 11:119429994-119430016 TCCCAGATTGGGGCGGGGGATGG - Intergenic
1089647471 11:119889681-119889703 TCCCAGAGGGAGGATGGGTATGG - Intergenic
1090413136 11:126522729-126522751 ACACTGAGGGACTCGGGGGAGGG - Intronic
1091218656 11:133918363-133918385 ACCCAGAGGGAAGCAGGGAGGGG + Intronic
1092106233 12:5923483-5923505 TCCCCGAGGGAGGTGGGGGCTGG - Intronic
1092217625 12:6694134-6694156 GCCCAAAGGGAGGCTGGGAAGGG + Exonic
1092230795 12:6774245-6774267 GCCCAGAGGGAGGGGGAGGGGGG + Intronic
1092249493 12:6884762-6884784 CACCACAGGGACGCGGGGGAGGG - Intronic
1092754659 12:11752341-11752363 AGCAAAAGGGAGGCGGGGCATGG - Intronic
1093941214 12:25056892-25056914 ACCCAGAGTGACTCTGGGGAGGG - Intronic
1094460903 12:30695873-30695895 AGCCGGTGGGAGGCGGGAGAAGG + Exonic
1094542139 12:31371438-31371460 ACCCAGAGGTGGGGGTGGGAGGG + Intergenic
1095570898 12:43684337-43684359 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1095732231 12:45518746-45518768 ACCCACAGGGAGGCTGATGAAGG - Intergenic
1095956971 12:47812613-47812635 ACGCAGAGGGAGGAATGGGATGG - Intronic
1096514074 12:52146767-52146789 ACCCAGAGTGAGGCCGAGGCAGG - Intergenic
1096525319 12:52206909-52206931 ACAGAGAGGGAGGTGGGGGCCGG + Intergenic
1096782136 12:53997608-53997630 GCAGAGAGGGAGGCGGAGGAAGG - Intronic
1097195559 12:57240805-57240827 ACCCAGATGGGAGCTGGGGACGG + Intergenic
1097265946 12:57745002-57745024 ATCCAGAGGCAGGGGAGGGACGG + Exonic
1097938595 12:65279212-65279234 AGCCCGCGGGAGGCAGGGGAGGG + Intronic
1097961142 12:65532952-65532974 ACCTAGAGGCAGGCTGGGGGAGG - Intergenic
1098161517 12:67650294-67650316 ACCCACGGGGAGGTGGGGGAAGG - Intronic
1098412686 12:70202111-70202133 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1098413010 12:70202826-70202848 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1100570677 12:95841391-95841413 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101984329 12:109433797-109433819 ATCCTGAGGGAGGCAGGGCATGG + Intronic
1102220130 12:111188629-111188651 ACCCAGAGAGCGGGGGGGAAAGG + Intronic
1102453315 12:113056969-113056991 CCCCAGCGGGAGCCGGGGGTGGG - Intronic
1102550104 12:113685419-113685441 ACATAGAGGGGGGCTGGGGAGGG + Intergenic
1102691638 12:114765942-114765964 AGACAGAGAGAGGAGGGGGAAGG - Intergenic
1103552745 12:121748266-121748288 ACTCAGAGGGAGGAGGGCTATGG - Intronic
1103856406 12:123973391-123973413 TCCCGGAGGGAGGCGGGGGCCGG + Exonic
1104277688 12:127344685-127344707 AGACAGAGGGCGGCGGGGGGTGG - Intergenic
1104332690 12:127862199-127862221 ACGCAGAGGGAGTGAGGGGATGG + Intergenic
1104882796 12:132084198-132084220 ACCCGGAGGGACGTGGCGGAGGG - Intergenic
1105405203 13:20127733-20127755 ACCCTGAGGGACGCGCGGGCTGG - Intergenic
1105446573 13:20462193-20462215 ACCTAGTGGGAGGAGGGGGCAGG + Intronic
1105795163 13:23844207-23844229 TACCAGAGGGAGGGGTGGGAAGG + Intronic
1105933482 13:25075098-25075120 ACAAAGAGGGAGGCTGGGCACGG + Intergenic
1106357686 13:28999778-28999800 TACCAGAGGCTGGCGGGGGATGG - Intronic
1108225151 13:48281868-48281890 ACCCTGAAGGAGCCAGGGGAAGG + Intergenic
1108304248 13:49115170-49115192 ACCCTGAGGGATGAGGGGGGGGG + Intronic
1108409089 13:50129910-50129932 ACCCAGTGGTGGGCGGGGGTGGG - Intronic
1108977255 13:56462894-56462916 GTCCAGAGGGAGTCAGGGGAAGG + Intergenic
1109599947 13:64612633-64612655 ACGGGGAGGGTGGCGGGGGATGG - Intergenic
1110190875 13:72727608-72727630 AGGCCGAGGGAGGCGGGAGAAGG + Exonic
1111226116 13:85273085-85273107 ACTCAGAGGGAAGAGTGGGAGGG + Intergenic
1112415532 13:99200867-99200889 CCCCAGAGGGCGCCGGGGGAGGG - Exonic
1113881322 13:113628434-113628456 CCCCAGCGAGAGGCGGGTGAGGG + Intronic
1114174611 14:20309329-20309351 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1114195050 14:20469609-20469631 GCCCAGAGGGAGCTGGCGGAGGG + Intronic
1114527380 14:23375370-23375392 ACCGTGAGGGAGGCAGGGGAGGG - Intronic
1114642403 14:24232394-24232416 ACCCAGTGGGGGGGGGGGGGGGG - Exonic
1115703399 14:35977071-35977093 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1115703471 14:35977239-35977261 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1116668582 14:47811775-47811797 ACTCAGAGGGAAGGGTGGGAGGG - Intergenic
1116868363 14:50049508-50049530 AGGAAGAGGGAGGCTGGGGAAGG - Intergenic
1116914519 14:50510328-50510350 ACGGGGAGGGAGGCGGGGAAAGG - Intronic
1117999340 14:61508624-61508646 ACCCAGATGGAAACTGGGGAGGG - Intronic
1118278929 14:64411176-64411198 ACCCAGGTGGAGGTTGGGGAGGG - Intronic
1118341172 14:64895696-64895718 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118758949 14:68866108-68866130 ATCCGGGGGGGGGCGGGGGATGG + Intergenic
1119139687 14:72255089-72255111 AGGCAGAGGGAGATGGGGGATGG + Intronic
1119324898 14:73753980-73754002 GGCCAGAGGGAGGCTGAGGAAGG + Intronic
1119392977 14:74303634-74303656 ACCCAAAGGGAGGTGGGAAATGG + Intronic
1119481452 14:74960792-74960814 ACCCAGTGGGAGGCCTGGGGTGG + Intergenic
1120193934 14:81463191-81463213 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193942 14:81463210-81463232 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193950 14:81463229-81463251 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193958 14:81463248-81463270 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193966 14:81463267-81463289 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1121006115 14:90491726-90491748 ACGCACAGGCAGGCGGGGGGAGG - Intergenic
1121408545 14:93733983-93734005 ACCTAGAAGGAGGCTGGGGAGGG - Intronic
1121495776 14:94390598-94390620 ACCAAGAAGGAGGAGGGGGTCGG - Exonic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122097812 14:99384237-99384259 GCCCAGAGGGAGGCGGGGATGGG + Intergenic
1122195523 14:100082174-100082196 GCCTGGAGGGATGCGGGGGAGGG - Intronic
1122347458 14:101069396-101069418 ACCCAGCTGGAGGTGGGGCAGGG + Intergenic
1122749736 14:103923923-103923945 ACACAGAGGGAGGGGGGGAGGGG + Intronic
1122847083 14:104505981-104506003 CCCCTGAGTGAGGCTGGGGAAGG + Intronic
1122879588 14:104684216-104684238 ACCGAGAAGGAGGCTGGGGAGGG + Intergenic
1122917932 14:104867348-104867370 ACACAGAGGCAGGGCGGGGATGG - Intronic
1124639637 15:31389492-31389514 ACACAGGGGGAGGAGGGAGAAGG - Intronic
1125234533 15:37497667-37497689 CCCCAGAGGAAGGAGGGGGAAGG + Intergenic
1125366306 15:38920379-38920401 ACTCAGAGGGTGGCAGGGCAGGG + Intergenic
1125637133 15:41198398-41198420 CCCCAAAGGGAGGCTGGGCAAGG + Intronic
1125677822 15:41511961-41511983 ACCCTGCGGGCAGCGGGGGAGGG + Exonic
1126104683 15:45139616-45139638 ACCCAGAGGGTAGGGCGGGAGGG + Intronic
1126589314 15:50323471-50323493 ACCCAGAGTGAGGCAGGGAGAGG + Intronic
1127072939 15:55302969-55302991 TCCAAGAGGGAGGTGGGGGGGGG + Intronic
1127270055 15:57392329-57392351 GCCTAGAGGGAGGTTGGGGAAGG + Intronic
1127584327 15:60366789-60366811 TCCGGGAGGGAGGCGGGGGGGGG + Intronic
1127584609 15:60367380-60367402 TCCGGGAGGGAGGCGGGGGGGGG + Intronic
1129339246 15:74874027-74874049 ACCCTGTGGGGGGCGGGGGCGGG - Intergenic
1129816754 15:78561971-78561993 ACCCAGTGAGAGGCTGGGGCAGG + Intergenic
1129868071 15:78924090-78924112 ACCCAGCGGGGGGGGGGGGGAGG + Intronic
1130035729 15:80359778-80359800 ATCCAGAGGGTGGCCGAGGAAGG - Intronic
1130520622 15:84658299-84658321 ACCTAGCGGGAGGGTGGGGACGG - Exonic
1130607635 15:85332060-85332082 ACACAGAGCGGGGCGGGGTAGGG - Intergenic
1130657095 15:85799277-85799299 AACCAGAAGGAAGCGGGGAAGGG - Intergenic
1131144358 15:90001730-90001752 CCCCAGGGAGAGGCGGGGGGCGG - Intronic
1131268934 15:90935055-90935077 ACCCAGAGGGAGGCCTGCGGTGG - Intronic
1132496063 16:264062-264084 ACCCCCAGGGAGGCTCGGGAGGG - Exonic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1132650927 16:1021160-1021182 ACCCAGGTGGAGGCGGGAGCCGG + Intergenic
1132794855 16:1714825-1714847 AACCAGAGGGAGTCGGAGGTTGG + Intronic
1132801755 16:1758110-1758132 ACGCACAGAGAGGCAGGGGAAGG - Intronic
1132832404 16:1935009-1935031 ACCCAGAGTTAGGCTGGGCATGG - Intergenic
1132843660 16:1990335-1990357 AACCTGAGGCCGGCGGGGGAGGG - Intronic
1133215912 16:4292452-4292474 ACCCAGAGGGACACTGGAGATGG - Intergenic
1133324794 16:4936292-4936314 ACCCAGAGGGTGGGGAGGTAAGG + Intronic
1134098580 16:11435878-11435900 ACCTGCAGGGAGGCAGGGGAGGG + Exonic
1134690052 16:16185109-16185131 CCCCTGGGGGGGGCGGGGGATGG - Intronic
1135376761 16:21953766-21953788 ACCCAGGGGGAGCGGGAGGACGG + Intronic
1135694710 16:24575799-24575821 AGGGAGAGGGAGGAGGGGGAGGG + Intergenic
1136056071 16:27690639-27690661 GCCAAGAGGGAGGTGGGGAAGGG - Intronic
1136072415 16:27795834-27795856 TCACTGAGGGAGGCGGGAGATGG - Intronic
1136172449 16:28497059-28497081 TCCCAGAGGCAGGCGGGGAGGGG + Exonic
1136429231 16:30187304-30187326 TCCCAGGTGGAGGCGAGGGAGGG - Intronic
1136538349 16:30913613-30913635 CCCCAGAGAGAGGCGGGTGGTGG - Intergenic
1137655588 16:50154890-50154912 ATGCAGAGGGTGGCGTGGGATGG + Intronic
1138282147 16:55780192-55780214 ACCCATTGGGAGGTGGGGGTGGG - Intergenic
1138286796 16:55816444-55816466 ACCCACTGGGAGGTGGGGGTGGG + Intronic
1138514645 16:57529275-57529297 GCCCAGAGGGAAGCGGGGCACGG - Exonic
1138522201 16:57577566-57577588 ACCCAGATGGTGGCAGGGGTGGG - Intronic
1138776517 16:59729865-59729887 ACCCAGAGGGTAGTGGGGGAAGG - Intronic
1139467045 16:67159673-67159695 ACACCGTGGGAGGCGGGGGACGG - Intronic
1139805883 16:69565590-69565612 CCCCAGAGGCCGGCGGCGGACGG - Intronic
1139864641 16:70052145-70052167 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1140049593 16:71468348-71468370 AGCCAGAGGGAGGCTGGGCATGG - Intronic
1140065917 16:71611102-71611124 ACCCAGGCTGAGTCGGGGGAGGG + Intergenic
1140442538 16:74998968-74998990 ACCCGGCGGGGGGAGGGGGAGGG + Intronic
1140473980 16:75229478-75229500 CCCAGGAGGGAGGCAGGGGAGGG - Exonic
1141136381 16:81468343-81468365 ACTCAGAGAGAGGCCGGGGCTGG + Intronic
1141224788 16:82104785-82104807 AGCCAGAGAGAGGGGAGGGATGG - Intergenic
1141432213 16:83976119-83976141 AGCCAGAGGGAGGCTGGGATTGG + Intronic
1141464173 16:84195708-84195730 CCCCCGGGGCAGGCGGGGGATGG + Intronic
1141659132 16:85432240-85432262 GCCCAGATGGAGGAGGGAGAGGG + Intergenic
1141683070 16:85555334-85555356 ACTCAGAGAGAGGGGGTGGAAGG - Intergenic
1141695039 16:85615077-85615099 ACACCGAGGGAGGCCAGGGAAGG - Intronic
1141697095 16:85625298-85625320 TCCCGGATGGAGGCGAGGGACGG - Intronic
1141906970 16:87033257-87033279 ACAAAAAGGCAGGCGGGGGATGG + Intergenic
1142034200 16:87853763-87853785 GCCCGGAGGGAGGCGGGGAGTGG + Intronic
1142106519 16:88306537-88306559 ACCCAGAGGGTGGTGGGGTGTGG + Intergenic
1142124343 16:88402724-88402746 GTCCAGAGGCAGGCGGGGGCCGG - Intergenic
1142169863 16:88616029-88616051 CCCCAGAGGAAAGCGGGTGACGG + Intronic
1142380526 16:89729463-89729485 AGTGAGCGGGAGGCGGGGGAGGG + Intronic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1142850135 17:2700823-2700845 ACCCTGTGGCAGGCAGGGGAGGG + Exonic
1143031257 17:3968545-3968567 ACCAAGTGGGAGGCCGGGCATGG - Intergenic
1143109340 17:4544684-4544706 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1143109349 17:4544706-4544728 GCGCACAGGGAGGCGGGGGTGGG + Intronic
1143217161 17:5233659-5233681 ACTGAGAGGCAGGCGGGGCATGG - Intronic
1143554291 17:7651105-7651127 AGGCAGAGAGAGGTGGGGGAGGG - Exonic
1143805724 17:9424519-9424541 AACCAGAGGCAGGGGGAGGAAGG - Intronic
1144760868 17:17706556-17706578 AGCCAGAGGGAGCCGGGGACTGG + Intronic
1144822975 17:18088362-18088384 ACCCAGAGAGAGGCGGAGCTGGG + Intronic
1144967919 17:19089434-19089456 GGCCGGAAGGAGGCGGGGGAGGG - Intergenic
1144979998 17:19162629-19162651 GGCCGGAAGGAGGCGGGGGAGGG + Intergenic
1144988224 17:19215603-19215625 GGCCGGAAGGAGGCGGGGGAGGG - Intronic
1145051298 17:19663696-19663718 AACCCGAGGGAGGAGGGGAATGG - Intronic
1145254733 17:21316384-21316406 AGCCACAGGAAGACGGGGGAGGG - Intergenic
1145321867 17:21771581-21771603 AGCCACAGGAAGACGGGGGAGGG + Intergenic
1145684065 17:26637527-26637549 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1145733441 17:27211288-27211310 AGGCAGAGGGAGACGGGAGAGGG - Intergenic
1146215977 17:30979536-30979558 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
1146229300 17:31094651-31094673 ACCCGGAGGCCGGCGGGGGAGGG + Intergenic
1146371425 17:32267098-32267120 ACCCTGAGGGAGGAGTGGGCAGG - Intronic
1146444136 17:32922207-32922229 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1146722533 17:35133240-35133262 ACCTAAAGGGAGGCAGAGGAAGG + Exonic
1146916245 17:36680194-36680216 CCCCAGAGGGAAGCGGGTGGTGG + Intergenic
1147138962 17:38451080-38451102 CCCCAGAGGGTGGTGGCGGAGGG - Intronic
1147277724 17:39333140-39333162 ACGGAGAGGGAGGAGGGAGAGGG - Intronic
1147382252 17:40062866-40062888 AGCCGGAGCGGGGCGGGGGAGGG + Exonic
1147389973 17:40103183-40103205 GCCCAGAGGGTGGAGGGAGAGGG - Intergenic
1148109745 17:45137712-45137734 GCCCAGAGGGAAGCTGTGGAGGG - Exonic
1148201359 17:45752097-45752119 GCCCAGATGGAGGTGGAGGATGG - Intergenic
1148436943 17:47692733-47692755 ACCCAGCAGGAGGAGGAGGAAGG + Intergenic
1148617864 17:49013989-49014011 ACCCAGAGGCCGGGGTGGGAGGG + Intronic
1148756117 17:49973815-49973837 TCCCAGAGGGAGGGGAGGGGTGG - Exonic
1148848951 17:50545186-50545208 ACACAGATGGAGGCAGGGCATGG - Intronic
1148850095 17:50550442-50550464 TCTCTGAGGCAGGCGGGGGAGGG - Intronic
1148870936 17:50658521-50658543 GGCCAGAGGGAGGGGAGGGATGG + Intronic
1148873505 17:50672950-50672972 CCCTGGAGGGAGGCGGGGGGTGG - Exonic
1149230937 17:54533104-54533126 ACCTAGAGGCAGGCTGGGCATGG - Intergenic
1150213613 17:63454965-63454987 ACCCACAGGGAGGGGAGGGAGGG - Intergenic
1150380462 17:64716009-64716031 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1151293456 17:73166291-73166313 GCCCTGAGGGAGGCGGGGGGTGG + Intronic
1151479353 17:74361255-74361277 TCGCAGAGGGAGGCGGGCGGGGG + Intronic
1151491141 17:74432770-74432792 ACCGAGAGGCAGGCGGTGGAGGG - Intronic
1151752256 17:76046275-76046297 ACCCAGAGGAAGCAGGGGGCGGG + Intronic
1151838688 17:76601695-76601717 ACCCACTGGGAGGCGGAGGCGGG - Intergenic
1152357763 17:79814988-79815010 ACCCCGAGGGTGGCGGTGGAGGG - Intergenic
1152491474 17:80637442-80637464 ATCCAGAGGGGGGCGGAGCAGGG - Intronic
1153854928 18:9136610-9136632 ACCAAGCGGCAGGCGGCGGAGGG - Intronic
1153993510 18:10420400-10420422 AGCCAAAGGGAAGCTGGGGAGGG + Intergenic
1155164112 18:23218859-23218881 GCCCTGATGGAGGCTGGGGAAGG + Intronic
1155409853 18:25531959-25531981 ACCCGGAGGAATGCGGGGTATGG + Intergenic
1156036022 18:32769612-32769634 ACAAAGAGGAGGGCGGGGGAGGG - Intronic
1156454316 18:37284472-37284494 AACCAGAGGGAGCCAAGGGAGGG - Intronic
1156866486 18:41894419-41894441 ACACAGAGGTAGGCTGGGCACGG - Intergenic
1157629656 18:49081513-49081535 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1158544822 18:58387034-58387056 ACACAGAGGGAGGCAGGTGATGG - Intronic
1158618890 18:59013140-59013162 AACCCCAGGGAGGCGGGAGAAGG - Intergenic
1159743991 18:72209402-72209424 GCCCACGGCGAGGCGGGGGAGGG - Intergenic
1160044131 18:75371081-75371103 ACCCAGCAGGAGGCAGGAGAGGG - Intergenic
1160367057 18:78335441-78335463 GGCCAGAGGGAGGAGGAGGAGGG + Intergenic
1160539814 18:79614372-79614394 ACCGGGAGGGAGGCTGTGGATGG - Intergenic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160789029 19:914294-914316 AGCAAGAGGGAGGCTGGGCACGG + Intergenic
1160814177 19:1027735-1027757 GCCCAGTGGGCGTCGGGGGAGGG - Intronic
1161050968 19:2163995-2164017 ACAAAGAGGGAGTCGGGGGCCGG + Intronic
1161237497 19:3205129-3205151 GCCCAGAGGGAGGCGGGGCGAGG - Intronic
1161241487 19:3225775-3225797 CCCAAGGTGGAGGCGGGGGAGGG - Intronic
1161249487 19:3272714-3272736 AGCCTGAGGGAGGGGGAGGAAGG + Intronic
1161296386 19:3522670-3522692 CCCAGGAGGGAGGCGGGGGCTGG - Intronic
1161583173 19:5091721-5091743 GCCCAGGGGGAGGCGGCAGAAGG + Intronic
1161649350 19:5474780-5474802 ACACGGAGGGAGGGAGGGGAGGG + Intergenic
1161950457 19:7464897-7464919 CCCAAGAGGAAGGCTGGGGAGGG + Intronic
1162335654 19:10058722-10058744 ACCCAGAGGGATGTGAGGGTGGG - Intergenic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162612806 19:11769052-11769074 ACCCATAGGGAGGTGGTGAAAGG + Intronic
1163092915 19:15033682-15033704 GCACAGAGGGAGGAGGGGTAAGG - Intergenic
1163144920 19:15373676-15373698 CCCAAGAGGGAGGCGGGGACAGG + Intronic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1163584518 19:18156545-18156567 GACCAGAGGGAGGAAGGGGAGGG + Intronic
1163633422 19:18428069-18428091 AGCCAGAGGAGGGCTGGGGATGG + Intronic
1163791179 19:19306881-19306903 ACCCACAGCAAGGCAGGGGATGG + Intronic
1163926756 19:20353251-20353273 ACACAGAGGGGGGAGGGGGGAGG - Intergenic
1164066518 19:21721329-21721351 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1164925035 19:32123929-32123951 AGCCAGAGGGAGGCGGAGGGAGG + Intergenic
1165386556 19:35513585-35513607 ACCCAGAGGGAGGGAGGACAGGG - Exonic
1165854524 19:38871476-38871498 TCCCAGAGGGAGGAGGGGATGGG - Intronic
1166162608 19:40965440-40965462 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1166361323 19:42254036-42254058 AGCCCGGGGGCGGCGGGGGAGGG + Intronic
1166887591 19:45971565-45971587 ACCTGGATGGAGGTGGGGGAGGG + Intronic
1166990816 19:46691692-46691714 ACCCAGAGGGAGCCCCGGGCTGG - Intronic
1167311570 19:48740361-48740383 AGTCAGAGGGAGGAGGGGGCTGG + Intronic
1167348893 19:48963045-48963067 ACCCAGAGAGAGGGGGGACAGGG - Intergenic
1167348921 19:48963142-48963164 ACCCAGAGGGACCCGGCGGGAGG - Intergenic
1167404180 19:49293473-49293495 ACCCAGTGGTAGCCGGGCGAGGG + Intronic
1167588879 19:50391681-50391703 ACTGAGAGGGGGGAGGGGGAGGG + Intronic
1167741478 19:51326996-51327018 GGCCTGAGGGAGGCGGGGGCTGG + Intronic
1167781276 19:51600907-51600929 ACCCAGAGAGAGACGGGGAAGGG - Intergenic
1167792730 19:51691226-51691248 ACCCAAAGAGAGAAGGGGGAGGG + Intergenic
1167881786 19:52465273-52465295 ACCCAGTGAGTGGTGGGGGAGGG - Intronic
1167970673 19:53186927-53186949 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
1167970972 19:53187595-53187617 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
1168136820 19:54357394-54357416 ACCCAGAAGGAGGTCAGGGAGGG - Intronic
1168572451 19:57482565-57482587 ACCGAGAGGGAGAGGGGAGAAGG - Intergenic
925009115 2:468495-468517 ACGCAGCGGGGGGCGGGGGGCGG + Intergenic
925035258 2:680166-680188 ACCCAGAGGCAGCCTTGGGAGGG + Intergenic
925656973 2:6159524-6159546 GCCCAGAGGGAGATGGGGGTAGG - Intergenic
925909937 2:8567188-8567210 ACCCAGAGACAGGTGGGGGCAGG - Intergenic
926136032 2:10337188-10337210 TCCCATAGGGAGGCCAGGGAGGG + Intronic
926152446 2:10432612-10432634 GCCCAGAGTGGGGCGGGGTAGGG + Intergenic
926294599 2:11559824-11559846 ACCCAGAGGTGGGGTGGGGAGGG - Intronic
926994919 2:18724421-18724443 CCACAGAGGGATGTGGGGGATGG + Intergenic
927461460 2:23302110-23302132 ACCCAAAGTGGGGGGGGGGAGGG - Intergenic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
928003201 2:27540529-27540551 ACCGGGAGGGAGGTGGGGGGGGG - Intronic
928005235 2:27557641-27557663 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
928242990 2:29602638-29602660 CCCCTGAGGGAGGCAGGTGAGGG - Intronic
928512445 2:32014033-32014055 ACAGAGAGGGAGGGAGGGGAGGG + Intronic
929808557 2:45169527-45169549 GCCCAGAGGGTGGCGGGGTTCGG - Intergenic
930034931 2:47079414-47079436 AGGCAGAGGGAAGCGGGGGCGGG + Intronic
930079095 2:47433051-47433073 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
930421409 2:51157684-51157706 TCCCAGAAGGAGGTAGGGGAAGG - Intergenic
930575270 2:53139394-53139416 AGGCTGAGGGAGGCGGCGGATGG - Intergenic
931214447 2:60228147-60228169 ACTCAGCGTGAGGAGGGGGAGGG - Intergenic
932435500 2:71700659-71700681 ACCCCGGGGGAGGCGGTGGGGGG + Intergenic
932449507 2:71800580-71800602 ACTCAGAGGGAGGCAGCTGATGG - Intergenic
932804152 2:74768666-74768688 ACCCAGAAAGAGGGAGGGGAGGG - Intergenic
934127915 2:88916379-88916401 AACCAGTGGGAGTTGGGGGATGG - Intergenic
934678522 2:96266319-96266341 ACGCAGGGGGAGGTGGGGGCGGG - Exonic
934859460 2:97751808-97751830 AGGAAGAGGGAGGTGGGGGAAGG + Intergenic
935192582 2:100790883-100790905 ACTGGGAGGGAGGCGGGGAATGG - Intergenic
935292248 2:101620546-101620568 ACTGAGAGGGTGGCTGGGGAAGG - Intergenic
935676376 2:105598077-105598099 AGGCAGAGGGAGGCAGGGAAGGG - Intergenic
936037593 2:109125228-109125250 TCCCAGAGTGTGGTGGGGGAGGG + Intergenic
936345760 2:111673723-111673745 ACCCAGACGCAGGCAGGGGCTGG + Intergenic
936469798 2:112788926-112788948 GCTCAGAGAGAGGAGGGGGAAGG + Intergenic
936514692 2:113174253-113174275 AGGCTGAGGGAGGAGGGGGACGG - Intronic
937039188 2:118807861-118807883 GCCCAGCGGGCTGCGGGGGAGGG + Intergenic
937284459 2:120741441-120741463 ACCCAGAGAGAAGAGGGGGTGGG - Intronic
937293490 2:120796175-120796197 ACCCAGCGGGATTCGGGGCATGG - Intronic
938261825 2:129902216-129902238 ACCCAGAGTGGGGCTGGGGCTGG + Intergenic
938534185 2:132222030-132222052 TCCGGGAGGGAGGCGGGGGGGGG + Intronic
940640465 2:156340955-156340977 CTCCAGAGGTAGGAGGGGGAAGG + Intronic
941188347 2:162344603-162344625 ACTGAGTGGGGGGCGGGGGAGGG - Intronic
941295837 2:163736838-163736860 ATTCACAGGGAGGCGGGGGAGGG - Intergenic
941768553 2:169326202-169326224 ACCGAGAGGGAGAGGGGAGAGGG - Intronic
941904271 2:170706032-170706054 CCCTAGATGGAGGCGGGGGTTGG - Intergenic
942450095 2:176103929-176103951 ACTCAGAGGGCGGCGGGGAAGGG + Intergenic
942545864 2:177062957-177062979 AAGCAGAGGGAGGCACGGGATGG + Intergenic
942653852 2:178194769-178194791 ACCCCGAGGGACGCGTGGGTGGG + Intronic
942776802 2:179591442-179591464 ACCCAGTGGGAGGAAGGGGTTGG + Intronic
944598797 2:201283691-201283713 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
945009517 2:205446260-205446282 ATCCTGAGGGAGGTGGGGCAGGG + Intronic
945233157 2:207611081-207611103 TCCGGGAGGGAGGCGGGGGGGGG + Exonic
945835613 2:214835096-214835118 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
945970363 2:216226570-216226592 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
946371831 2:219285820-219285842 CCCCAGAGGGAGGCCTAGGAGGG + Exonic
946781521 2:223196560-223196582 ACCCACAGGGAGGCAGCGGCAGG + Intronic
946921491 2:224585407-224585429 GCCCAGAGGGTGGAGGGGGGAGG + Intergenic
947702197 2:232243810-232243832 CCCCACAGGGAAGCGGGAGAAGG - Intronic
947810266 2:232999692-232999714 AGCCAGAGGGAGGAGGGCCAGGG + Intronic
948091845 2:235301929-235301951 AGCAGGAGGGAGGAGGGGGAAGG - Intergenic
948115787 2:235493870-235493892 GCCCAGAGGCAGGCGCGGGGCGG + Intergenic
948239270 2:236416117-236416139 ACCCAGAAGGAAGAGAGGGAGGG + Intronic
948293944 2:236847273-236847295 AGCCAGAGGGAGGCAGGGACCGG + Intergenic
948586110 2:239020768-239020790 CCCCAGAGGGAGGCAGGAGGGGG - Intergenic
948755197 2:240155374-240155396 AGTCAGAGGGAGGAGGGCGATGG - Intergenic
1169217892 20:3803977-3803999 ACCCAGGAGGAGGCAGGGGTGGG - Intronic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169470689 20:5882992-5883014 ACACAGAGGGAGGTGGTGGTGGG - Intergenic
1170710307 20:18784763-18784785 ACCGAGAGCGAGGTGGGTGAAGG + Intergenic
1171012325 20:21515307-21515329 ACCCAGAAAGCTGCGGGGGAGGG + Intergenic
1171342206 20:24439165-24439187 ACACAGAGGGATGTGGGTGAAGG - Intergenic
1171957673 20:31472412-31472434 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1172212369 20:33209875-33209897 ATCCAGAGAGAGGCAGTGGATGG + Intergenic
1172383507 20:34516327-34516349 AGCCAGCGTGAGGCGGGGGCGGG - Intergenic
1172590048 20:36111493-36111515 ACCCCGAGGGAGGCCGGGCATGG + Intronic
1173268556 20:41510125-41510147 ACCCAGAGGGCCCCGGGAGAAGG + Intronic
1173361936 20:42352360-42352382 AACCTTAGGGAGGCGGGGGAAGG + Intronic
1173801795 20:45898749-45898771 GCCCACAGGGAGGTGGTGGACGG + Exonic
1175196627 20:57248324-57248346 GCACAGTGGGAGGCAGGGGAGGG - Intronic
1175383004 20:58576631-58576653 ACCCAGGGGGCTGCAGGGGAAGG + Intergenic
1175831445 20:61967164-61967186 ACCCAGAGGGCTGCTGGTGAGGG + Intronic
1175977605 20:62719433-62719455 ACCGAGAGGGAGGGTGGAGATGG - Intronic
1175989940 20:62783610-62783632 GCCCAGGGGGAGCCGGGGCATGG - Intergenic
1176051338 20:63121016-63121038 ACACAGGGTGAGGCGGGGCAGGG + Intergenic
1176092376 20:63324977-63324999 ACCCAGAGTTGGGCAGGGGAGGG + Intronic
1176220805 20:63968690-63968712 ATCCAGAGAGAGGTGGGGGGCGG - Intronic
1176235024 20:64049963-64049985 TCCCAGCGGGGGGCGGGGAACGG - Intronic
1176261906 20:64186265-64186287 ACCCAGAGGGCGGCGCTGGCTGG - Intronic
1176414725 21:6467818-6467840 GCGAAGAGGAAGGCGGGGGAGGG - Intergenic
1177828180 21:26107039-26107061 ACCCTGAGGGTGGCGGGGAAAGG + Intronic
1178370553 21:32023569-32023591 AGTCAGAGGGAGCTGGGGGAGGG - Intronic
1178510027 21:33197135-33197157 TCCCAGAGGACTGCGGGGGAAGG - Intergenic
1178824634 21:36004971-36004993 AGACAGGGGGAGGCAGGGGAAGG + Intergenic
1179356493 21:40665187-40665209 ACACAGAGGCAGGCTGGGCATGG + Intronic
1179381976 21:40908300-40908322 CCCCAGTGAGAGGCAGGGGAGGG - Intergenic
1179458997 21:41521066-41521088 ACCCAGAGGGAGGCAGTTGCAGG + Intronic
1179626829 21:42653740-42653762 CCGCCGCGGGAGGCGGGGGAGGG - Exonic
1179690225 21:43076140-43076162 GCGAAGAGGAAGGCGGGGGAGGG - Intronic
1179953728 21:44726448-44726470 TCCCAGAGGAAGGAGGCGGAGGG + Intergenic
1179987119 21:44928068-44928090 ACGCAGAGGAAGGCAGAGGAGGG - Intronic
1180149692 21:45941201-45941223 ACCCAGGGCGAGCCTGGGGATGG + Intronic
1180595349 22:16969568-16969590 ACCCAGAGGGAGAGGGGAGGTGG - Intronic
1181043345 22:20203270-20203292 GCCCAGAGGGAGGGAGGGGTCGG + Intergenic
1181323314 22:22025445-22025467 GCCCATATGGAGGCTGGGGAGGG + Intergenic
1181386669 22:22550859-22550881 TCCCAGAGGGAGGCAGGTGAAGG + Exonic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1181680843 22:24494955-24494977 CCCCTGAGGGAGGCGGGAGGGGG + Intronic
1182578904 22:31291945-31291967 CCACAGAAGGAGGCTGGGGAAGG + Intronic
1182886386 22:33777623-33777645 ACAGAGAGGGAGGGAGGGGAAGG + Intronic
1183154710 22:36066119-36066141 ACCGAGAGGGAGGCGCGCCATGG - Intergenic
1183340887 22:37280702-37280724 ACCCAGGTGGAGGCAGGGCAGGG + Intergenic
1183546167 22:38455682-38455704 GGGCAGAGGGAGGCGGGGGGAGG - Intergenic
1183758139 22:39790010-39790032 ACCCACAGGCAGGAGGGGGCTGG + Intronic
1184299037 22:43544080-43544102 GCTCAGGGGGAGGCTGGGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184565429 22:45288990-45289012 ACCCACAGGGAGGCGGTGGGGGG - Intronic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1184837944 22:47035205-47035227 CCCCGGAGGCAGGCGGGGGTGGG - Intronic
1184913394 22:47550764-47550786 ACCGAGAAGGATGCGGGGGGCGG - Intergenic
1185161668 22:49233672-49233694 GAGCAGAGGGAGGTGGGGGATGG + Intergenic
1185276716 22:49953087-49953109 GCCCAGTGGGAGGAGGGGGCTGG + Intergenic
950110716 3:10417056-10417078 TCCCAGACGGCGGCGGGGGGGGG + Intronic
950430759 3:12949665-12949687 ACCCAGAGGAAGGAAGGGGATGG + Intronic
950482190 3:13251053-13251075 ACTGAGGGGGAGCCGGGGGAGGG - Intergenic
950755082 3:15164150-15164172 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
951906837 3:27714830-27714852 CCCCAGAGGGACGGAGGGGAAGG + Intergenic
952949918 3:38514758-38514780 AAGCAGGGGGAGGGGGGGGAGGG - Intronic
954065760 3:48104655-48104677 ACCCCGAGGGAGGCTGGGCACGG - Intergenic
954126903 3:48536660-48536682 ACCCTGTGGGAGACGGGAGATGG + Intronic
954389832 3:50262886-50262908 AGGCACAGGGAGGCGGGAGATGG - Intergenic
954714106 3:52518623-52518645 CCCCAGAGCGAGGCTGGGCAGGG + Intronic
956321251 3:67999270-67999292 ACACAGAGAGAGGGGGGGGGGGG - Intergenic
959415153 3:106073618-106073640 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
959415495 3:106074403-106074425 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
959683604 3:109123359-109123381 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
959817947 3:110698087-110698109 GCTAAGAGGGAGGCGGGGGGAGG - Intergenic
959991770 3:112638918-112638940 AACCAGAGAGAGTCGGGTGAAGG - Exonic
960662736 3:120078796-120078818 TCCCAGAGGGAGGCTGAGGCTGG - Intronic
960662786 3:120079186-120079208 TCCCAGAGGGAGACTGAGGAGGG - Intronic
960780553 3:121313609-121313631 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
960939742 3:122925847-122925869 ACACAGAGGGAGGGGGTGGGAGG + Intronic
961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG + Intronic
961519206 3:127456983-127457005 ACCAAGAGGGAGGGGGTGGATGG + Intergenic
961591016 3:127982053-127982075 ACACAGAGAGAGGTGGGGAAGGG - Intronic
961625290 3:128258144-128258166 ACCCTGAGAGAGGAGGAGGAAGG + Intronic
961664453 3:128487226-128487248 AACGAAAGGAAGGCGGGGGAGGG + Intronic
961756218 3:129128673-129128695 ACACAGCGGGAGGCCTGGGATGG - Intronic
962108469 3:132417560-132417582 AGGCAGAGGGAGGAGGCGGAGGG + Exonic
962318784 3:134374615-134374637 CCCCGGAGGAAGGCGGGGGCCGG - Intronic
962439046 3:135395075-135395097 ACACAGAGGGAGGGAGGGCATGG - Intergenic
963895736 3:150683472-150683494 ACCATGAGGGAGGCCGGGCATGG + Intronic
963911232 3:150820202-150820224 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
964479933 3:157130279-157130301 GCCCCGAGGGAGGCTGGGGTAGG + Intergenic
965646510 3:170887638-170887660 ACCCAGAGGGAGGCATAGGAGGG - Intergenic
966770219 3:183497528-183497550 ACCCAGAGGGGGTGAGGGGAGGG + Intronic
966861066 3:184230994-184231016 GCCCGGAGGAAGGCGGGGGACGG - Intronic
968753312 4:2401546-2401568 AGCCAGAAGGAGGAGGGGGAGGG - Intronic
968977945 4:3831474-3831496 ACCCAGATGGTGCCGCGGGATGG - Intergenic
969397392 4:6931187-6931209 ACCCAGAGTGAGGCCGGGCGTGG - Intronic
969857949 4:10015038-10015060 ACCCCGAGGGAGGGAGGGGTTGG + Intronic
970251626 4:14122370-14122392 ACCCAGAGGGGTGCTGGGGTGGG - Intergenic
971364649 4:25968051-25968073 TCCCTGTGGGAGGCTGGGGAGGG + Intergenic
971406214 4:26322099-26322121 ACCAGGAGGGGGGCGGGGGCCGG - Intronic
971757410 4:30721283-30721305 AGCGAGAGGGAGGGGAGGGAGGG - Exonic
973832851 4:54779289-54779311 ACAGGGAGGGAGGAGGGGGAGGG + Intergenic
975148410 4:70994200-70994222 TCGCAAAGGGAAGCGGGGGAAGG + Intronic
975661127 4:76689726-76689748 ACGGAGAGGGAGGCGGGGGCCGG + Intronic
975686115 4:76918058-76918080 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
976125515 4:81829879-81829901 ACCCAGAGGAAGGGGGAGGGAGG + Intronic
976264903 4:83181463-83181485 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
976265640 4:83185405-83185427 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
976743167 4:88378016-88378038 AACCAGAGGGTGGAGGCGGAAGG - Intergenic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
977602819 4:98952373-98952395 ACCCAGAGGGGTGAGGTGGACGG - Intergenic
978409162 4:108409678-108409700 ACCGGGAGGGAGGTGGGGGGGGG + Intergenic
979379066 4:119987035-119987057 TCCTAGTGGGAGGTGGGGGATGG + Intergenic
979531833 4:121776599-121776621 AGCCAGAGGGAGGCTTGGGTAGG - Intergenic
979547714 4:121956222-121956244 TCCCATAGTGAGGAGGGGGAGGG + Intergenic
980056691 4:128084609-128084631 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
981550706 4:145938059-145938081 ACCCAGAGTGAGGAGGGGGAAGG + Intronic
981567223 4:146114075-146114097 GCCCAGAGGGAGAAGGGTGATGG + Intergenic
982040439 4:151391026-151391048 ACCGGGAGGGAGGTGGGGGGCGG + Intergenic
982202801 4:152975681-152975703 ACCCGGAGGAAGGCGGGGAAGGG + Exonic
983050177 4:163037551-163037573 ATCCAGAAGGAGGCGGAGCATGG + Intergenic
983166422 4:164482351-164482373 AGTCAGAGGGAGGGTGGGGAGGG + Intergenic
984206553 4:176793073-176793095 ATCCAGAGGGGGGCCGGGGGAGG - Intergenic
984804106 4:183736676-183736698 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
985716898 5:1467861-1467883 AGAGAGAGGGCGGCGGGGGATGG - Intronic
985836621 5:2276652-2276674 ACACAGAGGGAGGCGTGGAGGGG + Intergenic
985896372 5:2751826-2751848 GACGGGAGGGAGGCGGGGGAGGG + Intergenic
986417499 5:7544093-7544115 ACCCAGAGTGGGGCAGGGAAAGG - Intronic
986572899 5:9183312-9183334 ACCCAGAGGGATGTCGGGTATGG - Intronic
986988198 5:13522624-13522646 GCCCAGAGGGAGCCAGGGGGTGG - Intergenic
987440169 5:17945931-17945953 ACCCAGGGGAAGTGGGGGGAGGG - Intergenic
987539555 5:19236430-19236452 TACCAGAGGGAGGGGGGGAAAGG + Intergenic
990459271 5:56015982-56016004 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
990536966 5:56732666-56732688 AGGAAGAGGGAGGCTGGGGAAGG + Intergenic
990738409 5:58888531-58888553 CCACAGAGGGAGGTGGGGAAGGG - Intergenic
990859346 5:60309223-60309245 AACATGAGGGAGGAGGGGGAGGG + Intronic
992021940 5:72633498-72633520 ACAGAGAGGGAGGCAGGGAAAGG + Intergenic
992023407 5:72647643-72647665 ACCCAGTGAGATGAGGGGGAGGG + Intergenic
992029308 5:72705206-72705228 ACCCAGAGGGTGGGGAGGGAGGG + Intergenic
992104313 5:73437195-73437217 AGCCGGCGGGAGGCGGGGAAGGG + Intergenic
993843471 5:92909884-92909906 AGCCAGAGGGTGCCGGCGGAGGG - Intergenic
995712137 5:115046676-115046698 AGACAGAGAGAGGCAGGGGAAGG + Intergenic
996586860 5:125098756-125098778 ACCCAGAAAGGGGCGGGGTAGGG - Intergenic
996614367 5:125422728-125422750 AGGCAGAGGGAGGTGGGGGTGGG - Intergenic
996862574 5:128083370-128083392 CCGCAGAGCGCGGCGGGGGAGGG + Intergenic
998431623 5:142075287-142075309 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
998567134 5:143225781-143225803 AGCCACAGGGAAGCTGGGGAGGG - Exonic
1000235929 5:159360558-159360580 ACTCAGAGGGAAGAGTGGGAGGG + Intergenic
1000504375 5:162096650-162096672 ACCCAGTGGGAGGTGGTGCAAGG + Intronic
1001244941 5:170098916-170098938 ACCCAGAGCGGGGAGAGGGAGGG + Intergenic
1001634009 5:173196910-173196932 ACCCACAGGGAAGTGGGGAAGGG + Intergenic
1001635010 5:173203420-173203442 AGAAAGAGGGAGGAGGGGGAGGG - Intergenic
1001761497 5:174211718-174211740 GCCCAGAGGGATGTGGGGGCTGG - Intronic
1001961847 5:175884328-175884350 ACCCAGAGGGGCTCGGGGGAAGG - Intergenic
1002001282 5:176197581-176197603 GCACAGAGGGAGGTGGGGGGAGG - Intergenic
1002253057 5:177941388-177941410 GCACAGAGGGAGGTGGGGGGAGG + Intergenic
1002297293 5:178238808-178238830 ACTGAGAGGGAGTGGGGGGAGGG - Intronic
1002542714 5:179916833-179916855 ATCCAGAGGGAGGGGAGGGAAGG - Intronic
1002567424 5:180119725-180119747 GCCCAGAGGGAGGAGGGCGCTGG - Intronic
1002614082 5:180439559-180439581 AGCCAGCAGGAGGCGGGGCAGGG - Intergenic
1002711472 5:181197732-181197754 ACCCAGAGGAGGGGAGGGGAGGG - Intronic
1002917422 6:1540581-1540603 ACCCAGGGGCAGGGTGGGGAGGG - Intergenic
1003024464 6:2541947-2541969 AACCAGAGGGAGATGGGGGAAGG + Intergenic
1003425303 6:5994894-5994916 ACCCAGGGGCACGCGAGGGAAGG - Intergenic
1004617378 6:17303496-17303518 AGACAGAGGAAGGGGGGGGAGGG + Intergenic
1005562667 6:27056664-27056686 TACCAGAGGGTGGAGGGGGAAGG - Intergenic
1005837283 6:29718878-29718900 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1006065267 6:31456512-31456534 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
1006273273 6:32980822-32980844 TCCTAGAGGGGGGCGGGGGGGGG - Exonic
1007738142 6:43994586-43994608 ACCAAGAGGGAAGTGGGGGAGGG - Intergenic
1009045995 6:58237915-58237937 ACCCAGATGGTGCCTGGGGAAGG - Intergenic
1010191520 6:73201698-73201720 ACACTTTGGGAGGCGGGGGAGGG - Intergenic
1011044759 6:83068416-83068438 ACCCTGAGGGGGGCGGGGAATGG + Intronic
1011626371 6:89286837-89286859 TTCCAGAGGGAAGCTGGGGAAGG + Intronic
1011845925 6:91562528-91562550 TCCCCTAGGGAGGTGGGGGAAGG + Intergenic
1012390287 6:98730266-98730288 ACCCAGAGGGAGACAGGGAAAGG - Intergenic
1013591649 6:111623809-111623831 AGCAACAGGGAGGTGGGGGAGGG - Intergenic
1014188653 6:118466023-118466045 ACACAGAGGGAGAGCGGGGAGGG + Intronic
1014376657 6:120683829-120683851 ACTCAGGGGAAGGCTGGGGAGGG + Intergenic
1015493632 6:133856259-133856281 ACCAAGGTGGAGGAGGGGGAGGG - Intergenic
1015955100 6:138590461-138590483 AACCAGAGGGAAGAGGGGCAGGG - Intronic
1017493299 6:154962840-154962862 CCACAGTGGGAGGCGGGGGCTGG - Intronic
1017590589 6:155974585-155974607 ACCCAGGGGCAGGCTGGGGCAGG + Intergenic
1018374244 6:163195836-163195858 ACCCAGGGGCGGGCGCGGGAAGG - Intronic
1018628889 6:165805356-165805378 CCCCGGAGGGAGGCGGAAGAAGG + Intronic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019388299 7:770847-770869 ACCCAGAGTGCTGTGGGGGAGGG - Intronic
1019421412 7:952967-952989 GCCCAGAGGGTGGCTGGAGAGGG + Intronic
1019458829 7:1146459-1146481 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1019459053 7:1146977-1146999 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1019476791 7:1248263-1248285 GCCCAGGGGCAGGCGGAGGAAGG - Intergenic
1019645089 7:2124709-2124731 ACCCAGAGGAGGGTGGGGCAGGG - Intronic
1020168690 7:5827847-5827869 ACCCAGAAGGAGAGGGGGCAGGG - Intergenic
1021451339 7:20785701-20785723 TCCGAGAGGGAGGAGGGAGACGG + Exonic
1022015413 7:26345006-26345028 ACGAAGACGGAGGAGGGGGAGGG - Intronic
1022508732 7:30922246-30922268 TCCCAGATGGAGGTGGGGGAAGG + Intronic
1023041405 7:36176071-36176093 TCCCAGCGAGAGGCAGGGGAGGG - Intronic
1023136598 7:37058936-37058958 ACCAAGGGGGATGCTGGGGAAGG + Intronic
1023375583 7:39552203-39552225 CCCCAGAATGAGGTGGGGGAGGG - Intergenic
1023878539 7:44306039-44306061 ACCCAGAGGGAGGGGGGTTGAGG + Intronic
1024001022 7:45189442-45189464 ACCCTGAGGGAAGCGGAGGCTGG - Intergenic
1024404417 7:48962358-48962380 AGACAGATGGAGTCGGGGGAGGG - Intergenic
1025097294 7:56106281-56106303 ACGCAGAGGGAGGCCGCGGGCGG - Intronic
1025796196 7:64739575-64739597 ACCAAGAGGGAGAGGGGAGAGGG + Intergenic
1025852929 7:65258413-65258435 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1025853338 7:65259306-65259328 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1025979453 7:66394127-66394149 TCCGGGAGGGAGGCGGGGGTGGG - Intronic
1025990163 7:66491551-66491573 ACCCGGCAGGGGGCGGGGGAGGG + Intergenic
1026656799 7:72263660-72263682 ACACTGTGGGAGGCGGAGGAGGG - Intronic
1026931172 7:74223796-74223818 AGCCAGAGGCAGGCTGGGGCTGG + Intronic
1026954990 7:74371503-74371525 GCCAGGAGGGAGGCGGGGGAGGG + Intronic
1027252511 7:76408183-76408205 AGCCAGAGAGAGGAGGGGGTTGG - Intronic
1028431340 7:90750117-90750139 ACACAGAGGGAGTGGGGAGAAGG + Intronic
1029569517 7:101360419-101360441 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
1029996426 7:105012718-105012740 ACCCAGGCCGGGGCGGGGGAGGG - Intergenic
1030602566 7:111609296-111609318 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1031007326 7:116488469-116488491 AACCAAAGGGAGGGGAGGGAGGG - Intronic
1032075378 7:128833446-128833468 TCCGAGAGGGAGGAGGGAGAGGG + Intronic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1032215356 7:129952942-129952964 GCCCAGAGCGAGGCTGGGGTAGG - Exonic
1032281484 7:130506315-130506337 TCCCAGAGGGGTGGGGGGGAGGG - Exonic
1033324006 7:140362888-140362910 TCCGGGAGGGAGGCGGGGGGGGG + Intronic
1033641975 7:143269876-143269898 ACCCAGAGGGAGGGATGGAAGGG - Intronic
1033654136 7:143362096-143362118 AGCCAGATGGAGGCGGCGGCGGG + Intronic
1034638472 7:152585582-152585604 TCCGGGAGGGAGGCGGGGGGGGG - Intergenic
1035828293 8:2668196-2668218 TCCCAGAGGGTGGCAGGGGCGGG + Intergenic
1036422842 8:8613948-8613970 AGTCAGAGGGAGGCAGTGGAAGG + Intergenic
1036541399 8:9715633-9715655 ACCCAGAGCAAGGTGGAGGATGG + Intronic
1036747655 8:11421303-11421325 AACCAGATGGAGGCAGGGGAGGG - Intronic
1036777833 8:11625677-11625699 ACGGTGAGGGAGGCTGGGGAAGG + Intergenic
1036782437 8:11658887-11658909 AGCCAGAGTGAAGCAGGGGAGGG - Intergenic
1037552252 8:19985911-19985933 ACCCAGAAGGAAGCAGGGAAAGG + Intergenic
1037605711 8:20435585-20435607 ACGCATAGGTAGGCAGGGGAGGG + Intergenic
1037819789 8:22130090-22130112 CCCCAGAGAGAGGCAAGGGAGGG + Intronic
1037912909 8:22754781-22754803 AACCAGAGAGAGGTGAGGGAGGG - Intronic
1038448420 8:27620783-27620805 AGCCAGAGGGAGGGAGGGAAGGG - Intergenic
1038729759 8:30116368-30116390 ATGGACAGGGAGGCGGGGGATGG + Intronic
1039230995 8:35448025-35448047 ACCAAAAGGGAGGCGGTGGTAGG - Intronic
1040340028 8:46435802-46435824 AGCCGCAGGGAGGCGTGGGAGGG - Intergenic
1042043794 8:64624893-64624915 ACCCAGGGGGAAGGGTGGGATGG - Intronic
1042708503 8:71688266-71688288 GTCAAGAGGGAGGCTGGGGAAGG - Intergenic
1043388337 8:79768602-79768624 ACCCGCAGGGAGCCGGGAGAGGG + Intergenic
1045368125 8:101494217-101494239 ACCACGAGGGAGGAGTGGGAAGG + Intronic
1046636299 8:116678848-116678870 ACCGGGAGGGAGGTGGGGGGGGG + Intronic
1046636820 8:116680022-116680044 TCCGGGAGGGAGGCGGGGGGGGG + Intronic
1047248719 8:123166063-123166085 ATACAGAGGGAGTCGGGGGCTGG + Intergenic
1047498806 8:125427259-125427281 GCCCAGTGGGAGGCCCGGGAGGG - Intergenic
1047574604 8:126138945-126138967 AGCAAGAGAGAGGCGGGGGAAGG - Intergenic
1047959064 8:129997695-129997717 ACCTAGTGGCAGGAGGGGGAGGG - Intronic
1048833586 8:138497952-138497974 ACCCAGGAGGAGGCAGGGAATGG + Intergenic
1049062581 8:140287369-140287391 AAGCAGAGGGAGGAGGGGCATGG + Intronic
1049180171 8:141218171-141218193 ACCGAGAGTGAGGAGGGGGAGGG - Exonic
1049252449 8:141596574-141596596 ACTCAGGAGGAGGCTGGGGAGGG + Intergenic
1049253189 8:141600192-141600214 ACCTAGAGGCTGGAGGGGGAAGG + Intergenic
1049270875 8:141695581-141695603 ACCCCTAGGGAGGCTGGGAAAGG + Intergenic
1049271722 8:141699648-141699670 ACCCTAAGGGAGGCTGGGAAAGG + Intergenic
1049303412 8:141883813-141883835 GCCCAGTGGGAGGCTTGGGAGGG - Intergenic
1049715254 8:144086740-144086762 ACCCAGGGGCAGGCGGGGCACGG + Intergenic
1051001410 9:12287015-12287037 ACCCTGTGAGAGGAGGGGGAGGG + Intergenic
1052142418 9:25003860-25003882 AGGCAGAGGGTGGCGGGGGAGGG + Intergenic
1053135319 9:35647083-35647105 ACCCTGGAGGAGGCGGGGGTTGG - Intergenic
1053476328 9:38384542-38384564 GCCCAGAGGGAAGCAGGTGAGGG - Intergenic
1054906581 9:70418859-70418881 ACCCAGGGGCTGGAGGGGGAAGG + Intergenic
1056152324 9:83803239-83803261 ACCGAGAGGGAGAGGGGAGAGGG - Intronic
1056233523 9:84570059-84570081 ACCCACAGAGAGGCTGGGCACGG + Intergenic
1057142255 9:92734735-92734757 GCCCACAGTGAGGCAGGGGAAGG - Intronic
1057147084 9:92765313-92765335 CCCCAGGGGGAGGCGGGTGCGGG + Intergenic
1057210403 9:93198212-93198234 ACCCAAAGGGAGGAGGGAGCTGG - Intronic
1057221434 9:93259750-93259772 AGGCTGAGGGAGGCGGGGGCTGG + Intronic
1057337329 9:94166275-94166297 ACCCGGATGGAGGCGCGGGCGGG - Intergenic
1059191797 9:112333720-112333742 GCCCCGAGGGAGGGCGGGGACGG - Intergenic
1059328664 9:113520606-113520628 ACCCAGAGGGAGGCTGGCAGGGG - Intronic
1060103933 9:120862063-120862085 GCCCAGAGGGAGGCGCCGCAGGG + Intronic
1060135617 9:121150425-121150447 ACCCATAGGGATGAAGGGGATGG - Exonic
1060157074 9:121327362-121327384 ACCCACAGGTAGGCGGCTGAGGG - Exonic
1060497920 9:124131411-124131433 AAGCAGAGGGGAGCGGGGGAAGG + Intergenic
1060550634 9:124483352-124483374 TCCCCGAGGGAGGCTGGTGATGG - Intronic
1060704054 9:125781529-125781551 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1060996349 9:127876658-127876680 ACCAGGAGGGGGGCGGGGCAGGG - Intronic
1061059926 9:128245182-128245204 CCCCAGAGGGCGGCTGGGGGAGG - Intronic
1061220312 9:129246709-129246731 GGACAGAGGGAGGCGCGGGAGGG + Intergenic
1061276668 9:129572662-129572684 ACCCAGCGGGGGGCAGGGGCGGG + Intergenic
1061295702 9:129675610-129675632 ACAGACAGGGAGGCGGGGGTGGG - Intronic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061415417 9:130444754-130444776 ACCTGGTGGGAGGCGGGGGGAGG + Intergenic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1061801378 9:133115081-133115103 ACCCAGAGGGAGTCTGGGTTTGG - Intronic
1061886733 9:133594864-133594886 GCCCAGAGGCAGGCAGGGCAAGG + Intergenic
1061925115 9:133802406-133802428 AGCCGGAGTGGGGCGGGGGAGGG - Intronic
1062084461 9:134641653-134641675 GCCCAGTGGGAGGCGGGGGCTGG + Intergenic
1062102951 9:134737950-134737972 ACCTGGAGGGAGGCGGGGTCTGG + Intronic
1062123645 9:134847948-134847970 ACCCAGACGCAGGCTGGGGGCGG + Intergenic
1062125908 9:134862573-134862595 ATCCATAGGGAGGCTGGGGGTGG + Intergenic
1062261475 9:135665196-135665218 ACCCTGAGGGTGGCGGGGCCAGG + Intronic
1062391693 9:136336399-136336421 GCCCAGCGGGAGGCAGGGGGTGG + Intronic
1062485148 9:136770573-136770595 ACCCAGAGGCAGGCGGGGTGCGG - Intergenic
1062566804 9:137167232-137167254 ATTCAGAGGGAGGCGTGGGTGGG + Intronic
1062656732 9:137607455-137607477 ACGCGGAGGGAGGCCTGGGAGGG + Intronic
1185709993 X:2296333-2296355 CCCCAGAGGGAGGGGAGGGAAGG + Intronic
1186361965 X:8851788-8851810 AACCAGAGGGAGGCCGGGCATGG + Intergenic
1186435970 X:9543470-9543492 AGCAAGAGGGAGGAGGGGGGAGG - Intronic
1186496275 X:10015003-10015025 ACCCCGAGGGAGACTGGGGGCGG + Intergenic
1186806240 X:13143047-13143069 GCCCAGAGGGAGGCTGAGAAGGG + Intergenic
1188367676 X:29333801-29333823 TCCGGGAGGGAGGCGGGGGGGGG - Intronic
1188469188 X:30518118-30518140 AACCAGAGTTGGGCGGGGGATGG + Intergenic
1188984274 X:36755421-36755443 AGCCTGAGGCAGGCAGGGGAGGG - Intergenic
1189304836 X:39979211-39979233 AGCCAGGGAGAGGCTGGGGATGG - Intergenic
1189332977 X:40154413-40154435 ACAAAGGGGGAGGAGGGGGACGG - Intronic
1189667748 X:43375574-43375596 ACCCCGTGGAAGGTGGGGGAAGG - Intergenic
1190101086 X:47523682-47523704 GGCCAGGGGGAGGCAGGGGAAGG - Intergenic
1190743509 X:53306341-53306363 GTCCAGAGGGAGGCAGGGGCAGG + Intronic
1190749300 X:53347008-53347030 ACCCAGAGAGGGGCCGGGCACGG - Intergenic
1190779292 X:53579016-53579038 TCCGGGAGGGAGGCGGGGGGGGG + Intronic
1191136466 X:57070096-57070118 ACCAGGCGGGAGGCGAGGGATGG - Intergenic
1192219816 X:69190145-69190167 AACCAGGGGGAGGAGGGGCAGGG - Intergenic
1192362341 X:70447673-70447695 AGCCAGAGAAAGGTGGGGGAGGG + Intronic
1192567899 X:72179171-72179193 TCCGGGAGGGAGGCGGGGGGGGG + Intergenic
1192768346 X:74165699-74165721 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1194749791 X:97671391-97671413 AGCCAGAGGGAGGCTTGTGAAGG - Intergenic
1195210780 X:102651308-102651330 ACCCAGAGGTGGGCGGGGCCAGG - Intergenic
1195446743 X:104960707-104960729 ACTTGGAGGGAGGAGGGGGAAGG - Intronic
1196750736 X:119115345-119115367 ACCCAGGGGGAGGTCAGGGAGGG - Intronic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1198440653 X:136659928-136659950 TCCGAGAGGGTGGCGGGGGGGGG - Exonic
1198534693 X:137574496-137574518 AGCCACGGGGAAGCGGGGGAGGG - Intronic
1200279307 X:154763057-154763079 AACCAGAGGGAGGCGTGCGCGGG - Intronic