ID: 914456413

View in Genome Browser
Species Human (GRCh38)
Location 1:147841146-147841168
Sequence CAGGGAACCCAGAGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 999
Summary {0: 1, 1: 2, 2: 19, 3: 68, 4: 909}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914456413_914456420 -4 Left 914456413 1:147841146-147841168 CCCGCCTCCCTCTGGGTTCCCTG 0: 1
1: 2
2: 19
3: 68
4: 909
Right 914456420 1:147841165-147841187 CCTGATGAAGACACCTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914456413 Original CRISPR CAGGGAACCCAGAGGGAGGC GGG (reversed) Intergenic
900123756 1:1060427-1060449 CAGGGAGCGCCGAGGGGGGCCGG + Intergenic
900201685 1:1410608-1410630 AAGGGAACGCAGAGGCTGGCGGG + Intergenic
900400782 1:2472070-2472092 CAGGGATCCCAGAGTCAGGCTGG - Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900526017 1:3129024-3129046 CAGGAAACCAGGAGGGAGTCTGG + Intronic
900546093 1:3230065-3230087 CAGGGATCCCAGAGAGCTGCAGG - Intronic
900577117 1:3388898-3388920 CATGGAACCATGAGGGATGCGGG - Intronic
900640433 1:3685717-3685739 CAGGGGTCCCAGAGTGGGGCTGG + Intronic
901053920 1:6440058-6440080 CAGGGACCTCTGAGGGAGGGTGG + Intronic
901948936 1:12726043-12726065 CAGAGAGCCCTGTGGGAGGCTGG - Exonic
901954576 1:12775052-12775074 CAGGGACCCTAGAGGAAGGCAGG - Exonic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
901972299 1:12917877-12917899 CAGGGACCCTAGAGGGAGGCGGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902012880 1:13283885-13283907 CAGGGACCCTAGAGGGAGGCGGG + Exonic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902248157 1:15135482-15135504 AAGGGAACTCAGAGGCCGGCGGG - Intergenic
902281663 1:15379160-15379182 AAGGGAACTCAGAGGCTGGCGGG - Intronic
902360745 1:15941463-15941485 CAGGCAACCCAGAGCGAGCCTGG - Intergenic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
902841473 1:19076870-19076892 CCAGTAACACAGAGGGAGGCTGG - Exonic
903034623 1:20485900-20485922 GAGGAAACCCGGAGGGAGGGTGG + Exonic
903122822 1:21227389-21227411 CCCTGAAGCCAGAGGGAGGCTGG + Intronic
903224945 1:21889214-21889236 CAGGGAACTGAGATGGAGACAGG + Intronic
903360530 1:22774190-22774212 CAGGAAACCCAGAGGAAGAAGGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904269197 1:29338225-29338247 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
904272586 1:29360125-29360147 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
905016208 1:34780641-34780663 CAGGGACTCCCAAGGGAGGCTGG + Intronic
905257588 1:36694803-36694825 GAGAGAACCCAGCTGGAGGCAGG + Intergenic
905440027 1:37989756-37989778 GAGGGAGCCCGGAGGAAGGCAGG + Intronic
905762628 1:40572829-40572851 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
905812016 1:40919770-40919792 CAGGGACCCAAGAGGAAAGCAGG + Intergenic
906146540 1:43563964-43563986 CAGGGAAACCCGAGGAAGGAGGG + Intronic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906402366 1:45514305-45514327 AAGGGAACTCAGAGGCCGGCGGG + Intronic
906404238 1:45528903-45528925 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
906498277 1:46321098-46321120 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907120887 1:52007046-52007068 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
907306466 1:53515902-53515924 CGGAGAAGCCAGAGCGAGGCTGG - Intronic
907476713 1:54710680-54710702 CATGGCACCCAGAGGAGGGCTGG - Intronic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
908543167 1:65140596-65140618 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
908656609 1:66395056-66395078 CAGAGAACCCAGAGGGATAAGGG + Intergenic
908659960 1:66424958-66424980 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
909132947 1:71762216-71762238 CAGGTAACCCACAGGAATGCAGG + Intronic
909234049 1:73129441-73129463 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
909413249 1:75377888-75377910 AAGGGAACTCAGAGGCTGGCGGG + Intronic
909413900 1:75383293-75383315 AAGGGAACTCAGAGGCTGGCGGG + Intronic
909651721 1:77983017-77983039 AAGGGAACTCAGAGGCTGGCGGG - Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910604316 1:89067006-89067028 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
911010590 1:93276925-93276947 AAGGGAACTCAGAGGCTGGCGGG - Intronic
912446154 1:109738398-109738420 TAGGGAATCAAGAGAGAGGCAGG - Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913530991 1:119734202-119734224 CAGGGAGTCCTGAGGGAGGGAGG - Intronic
913972164 1:143423689-143423711 TGGGGATCCTAGAGGGAGGCGGG - Intergenic
914066545 1:144249302-144249324 TGGGGATCCTAGAGGGAGGCGGG - Intergenic
914112608 1:144717052-144717074 TGGGGATCCTAGAGGGAGGCGGG + Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914443988 1:147733985-147734007 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
915346977 1:155202542-155202564 GAGGGAACCCCGAGGGAAGTGGG - Intronic
915397873 1:155599680-155599702 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915401737 1:155626809-155626831 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915402642 1:155635021-155635043 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915480300 1:156180025-156180047 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
915480624 1:156182262-156182284 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915838502 1:159197180-159197202 CAGGGACCCCAGTGGTGGGCTGG - Intronic
916010342 1:160699851-160699873 AAGGGAACTCAGAGGCTGGCGGG + Intronic
916048347 1:161017641-161017663 AAGGGAACTCAGAGGCTGGCGGG + Intronic
916092149 1:161315850-161315872 AAGGGAACTCAGAGGCCGGCGGG - Intronic
916311935 1:163407462-163407484 CAGGGAACCCAGAGGGTTTTAGG - Intergenic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
917027484 1:170659847-170659869 CAGGGCACCCATAGGCAAGCCGG - Intergenic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
918402891 1:184181166-184181188 CAGGGAACCCAAACTGAGGTGGG + Intergenic
919711216 1:200731187-200731209 CAGGGACCCAAGAGTGGGGCAGG + Intergenic
920796451 1:209142008-209142030 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922305475 1:224340633-224340655 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
922338668 1:224638229-224638251 CTGCGCACCCAGGGGGAGGCCGG + Intronic
922715460 1:227868483-227868505 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
922876058 1:228940700-228940722 CAGGGGACCCAGTGGGACGAGGG - Intergenic
923348364 1:233079751-233079773 CAGCGAACACAAAGGAAGGCTGG - Intronic
923782862 1:237041960-237041982 CAGGGACCCCAGCGGGGCGCAGG + Intergenic
924199930 1:241648063-241648085 CAGGGGACAAAGAGGTAGGCAGG - Intronic
924440542 1:244082106-244082128 CAAGGACCCCAGAGGGTGGAGGG + Intergenic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
924764110 1:247015926-247015948 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1063389756 10:5641578-5641600 CAGGGAACCCAGGGAGAGCTGGG + Intronic
1063531191 10:6832817-6832839 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064282190 10:13960873-13960895 CACTGAACCCAGAGGAGGGCAGG + Intronic
1064458010 10:15506819-15506841 GGGGGGACCCAGTGGGAGGCAGG - Intergenic
1065553807 10:26894272-26894294 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1065637191 10:27744329-27744351 CGGAGACCCCAGAGAGAGGCGGG - Intronic
1065695242 10:28373673-28373695 TAGGGGACCCAGGGAGAGGCAGG - Intergenic
1065695250 10:28373692-28373714 CAGGGGACCCAGGGAGAGGTAGG - Intergenic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1065960532 10:30730941-30730963 CAGGGAAGCCAGAGGGGTGTGGG + Intergenic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066209725 10:33224889-33224911 CAAAGAACCCAGAGAGAGCCGGG - Intronic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1066927325 10:41713988-41714010 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1067101502 10:43338005-43338027 AAGGGAACGCAGAGGCTGGCGGG + Intergenic
1067582149 10:47452644-47452666 CTGGGAAGCTGGAGGGAGGCAGG - Intergenic
1067961567 10:50857891-50857913 AAGAGAACCCAGCAGGAGGCTGG + Intronic
1069184772 10:65409373-65409395 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1069452146 10:68526471-68526493 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1069828832 10:71270563-71270585 TAGGGAGCCCAGAGAGAGGAAGG + Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070369756 10:75771118-75771140 CAGTGAATCCAGAGCTAGGCAGG - Intronic
1070415469 10:76185218-76185240 CAGGAAACCTACAGGCAGGCTGG - Intronic
1070783850 10:79151956-79151978 CAGGGGGCCCAGATGGCGGCGGG - Intronic
1072669214 10:97416981-97417003 AAGGGAACTCAGAGGCCGGCGGG - Intronic
1072891497 10:99329294-99329316 CTGGGAACCCAGCCGCAGGCAGG - Exonic
1072947232 10:99820955-99820977 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1073286421 10:102392240-102392262 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1073455455 10:103634135-103634157 CAGGGATCCCGGATGGAGGATGG - Intronic
1074504807 10:114060149-114060171 CAGGGAAACCCCAGGTAGGCTGG + Intergenic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1074711157 10:116178710-116178732 AAGGGAGCCCTGAGCGAGGCTGG + Intronic
1075253142 10:120900280-120900302 CCGAGAACCCAGAGGCAGCCTGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075729499 10:124627810-124627832 CTGGGAAGCCCTAGGGAGGCCGG - Intronic
1076064194 10:127435919-127435941 CAAAGAACCCAGAGAAAGGCAGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076353175 10:129832568-129832590 CAGGAGACCCACTGGGAGGCTGG + Intergenic
1076459300 10:130628754-130628776 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1076680801 10:132170273-132170295 CAGGGTCCCCCGAGGGCGGCTGG + Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076881225 10:133240124-133240146 CAGAGACCCCAGAAGGAGCCAGG - Exonic
1076930407 10:133528362-133528384 TAGAGAACCCAGAGGGACGTGGG - Intronic
1076995101 11:293941-293963 CAAGGGGCCCAGTGGGAGGCAGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077297406 11:1832576-1832598 CCGGGAGCCATGAGGGAGGCCGG + Intronic
1077315641 11:1918285-1918307 CCGGGCACTCAGCGGGAGGCAGG + Intergenic
1077493161 11:2871412-2871434 CAGGGAGGCTAGAGGAAGGCGGG - Intergenic
1077498865 11:2899930-2899952 CAGGGAACCCAGGAGGCGTCTGG + Intronic
1077953811 11:6991356-6991378 TAGGGAAACCAGAGGCAGGGAGG - Intergenic
1078033391 11:7776872-7776894 CAAGTAACCCACAGGAAGGCAGG + Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078098326 11:8313742-8313764 GAGGGCACCCAGAGGGAAGGTGG + Intergenic
1078327345 11:10391452-10391474 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1079770040 11:24446887-24446909 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1080644896 11:34181401-34181423 CAGGGACCCCAGAGTGAGTCAGG + Intronic
1080790742 11:35520545-35520567 CAGAGAACCCAGAGGCCAGCTGG - Intronic
1081289391 11:41305948-41305970 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1081565766 11:44260157-44260179 CAGGGAAGCTAGAAGGGGGCAGG - Intergenic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082790390 11:57342862-57342884 CAGGGAGCCAAGGAGGAGGCTGG - Intronic
1083236865 11:61356666-61356688 CAGGGACCCCAGCAGCAGGCAGG + Exonic
1083285342 11:61655156-61655178 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1083372854 11:62195463-62195485 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1083467539 11:62858659-62858681 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1083543058 11:63528114-63528136 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1083631768 11:64099115-64099137 GTGGCAATCCAGAGGGAGGCAGG - Intronic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083776636 11:64897373-64897395 CAGGGACCCTGGAGAGAGGCTGG + Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1084147024 11:67270415-67270437 CAGGGAAGCCAGAAAGGGGCAGG - Intronic
1084207347 11:67603497-67603519 AAGGGAACTCAGAGGCTGGCGGG - Exonic
1084218321 11:67663490-67663512 CAGGGAGCTCAGAGAGAGCCAGG + Intronic
1084247335 11:67868107-67868129 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1084296559 11:68216120-68216142 CAGGGAAGCCAGGGCTAGGCTGG + Intergenic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084366746 11:68706424-68706446 CAGGGAACTCAGTGTGGGGCTGG - Intergenic
1084564582 11:69921788-69921810 CAGGACACCCCGAGGAAGGCTGG + Intergenic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084880154 11:72165176-72165198 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1085247367 11:75113958-75113980 CAGGTAACTCACAGGGAGACAGG + Intronic
1085544168 11:77301684-77301706 AAGGGCAGCCCGAGGGAGGCGGG + Intronic
1085710986 11:78829110-78829132 CAGGGACCCAGGAGGAAGGCTGG - Intronic
1087723787 11:101695865-101695887 AAGGGAACTCAGAGGCTGGCAGG + Intronic
1087724719 11:101704363-101704385 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1087763866 11:102128952-102128974 TAGGGAAGCGAGAGGGAGGGAGG - Intronic
1088267480 11:108001584-108001606 CAGGGAACCCAGGGAGAGAATGG - Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1089111736 11:116062704-116062726 CAGCTCACGCAGAGGGAGGCAGG + Intergenic
1089128756 11:116195515-116195537 CCAGGAAACCAGAGGGAGTCAGG + Intergenic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089471156 11:118721158-118721180 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1089472051 11:118729350-118729372 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1089516999 11:119039412-119039434 AAGGGAACTCAGAGGCCGGCGGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1091250740 11:134141756-134141778 CAAGGGGCACAGAGGGAGGCAGG + Intronic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1091803441 12:3339698-3339720 CAGGGAACCCAGGGCAAGGCAGG + Intergenic
1091803462 12:3339782-3339804 CAGAGAACCCAGGGCAAGGCAGG + Intergenic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091963811 12:4721375-4721397 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1092142198 12:6191465-6191487 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1092152794 12:6262549-6262571 CAGGACACCCAGCGGGAGCCTGG + Intergenic
1092249629 12:6885997-6886019 AAGGGAACTCAGAGGCTGGCAGG - Intronic
1092437588 12:8462734-8462756 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1092559888 12:9601267-9601289 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1093886900 12:24472203-24472225 AAAGGAACCCAGAGGAAGTCTGG + Intergenic
1094092237 12:26663039-26663061 CAGGGAACCCAGATGGATCTAGG - Intronic
1094389299 12:29932197-29932219 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1094623274 12:32100313-32100335 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1096127138 12:49128221-49128243 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096134090 12:49185273-49185295 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096145049 12:49272948-49272970 CAGGCACCACAGTGGGAGGCTGG - Exonic
1096420630 12:51454430-51454452 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1096940110 12:55334233-55334255 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097076739 12:56400504-56400526 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1097330460 12:58327602-58327624 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1097331396 12:58336091-58336113 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1098750970 12:74292913-74292935 CAGAGACCCCAGAAGGAGCCGGG - Intergenic
1100276359 12:93075204-93075226 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1101520590 12:105478702-105478724 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1102135513 12:110570840-110570862 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1102505388 12:113381278-113381300 GAGGAAAGCAAGAGGGAGGCAGG - Intronic
1102605296 12:114063839-114063861 CCAGTAACCCAGAGGGAGTCAGG - Intergenic
1102605305 12:114063875-114063897 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605354 12:114064019-114064041 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605433 12:114064308-114064330 CCAGTAACCCAGAGGGAGTCAGG - Intergenic
1102605452 12:114064380-114064402 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605462 12:114064416-114064438 CTGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605471 12:114064452-114064474 CCGTTAACCCAGAGGGAGTCAGG - Intergenic
1102605480 12:114064488-114064510 CCGGTAACCCAGAGGGAGTCAGG - Intergenic
1102605490 12:114064524-114064546 CCGTTAACCCAGAGGGAGTCAGG - Intergenic
1102605498 12:114064560-114064582 CTGGTAAACCAGAGGGAGTCAGG - Intergenic
1102606619 12:114072758-114072780 CTGGTAACCCAGAGTGAGCCAGG - Intergenic
1103092428 12:118106778-118106800 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1103119828 12:118371948-118371970 CAGGACACCTAGAGAGAGGCCGG - Intronic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1103477877 12:121232111-121232133 CAGGGTCCCTTGAGGGAGGCAGG + Intronic
1103484525 12:121273903-121273925 CAGGGAACCTTGGGGGCGGCTGG - Intronic
1103930498 12:124448289-124448311 CAGGGGCCCCAGAGCAAGGCAGG + Intronic
1103953637 12:124565343-124565365 CAGGGAAGCCAGACAGAGCCCGG + Intronic
1104214561 12:126723422-126723444 CAGGGAACTCACATGGGGGCTGG + Intergenic
1104869348 12:131983518-131983540 CAGGGCACTGACAGGGAGGCCGG + Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1105900090 13:24746097-24746119 CAGGGATCCCGGAGCGAGGAAGG - Intergenic
1107709879 13:43141223-43141245 GAGGGAACCCAAATGGAAGCAGG + Intergenic
1107821378 13:44288769-44288791 CAGGGACCCTAGGGGGAAGCCGG - Intergenic
1108352487 13:49599825-49599847 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1108502835 13:51084133-51084155 CAAGGAATCCAGATGGAGTCAGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109959748 13:69615019-69615041 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1110011834 13:70345543-70345565 CATGCAACCCACAGGGTGGCAGG - Intergenic
1110076415 13:71250018-71250040 CAGGGAAGCCACAGGGAAGGTGG - Intergenic
1110681183 13:78313889-78313911 AAGGGAGCCCAGAGAGAGCCAGG + Intergenic
1110694456 13:78471919-78471941 AAGGGAACTCACAGGGAGACAGG - Intergenic
1111549220 13:89784719-89784741 CCGTGAAGCCAGAGGGAGCCAGG - Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1111924249 13:94445958-94445980 CCTGGAACCCAGAGGGGGCCAGG - Intronic
1112002881 13:95228184-95228206 GAGAAAACCCAGAGGGAGACGGG + Intronic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1114170656 14:20269725-20269747 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1114438086 14:22724828-22724850 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1115898589 14:38118902-38118924 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1117365689 14:55025338-55025360 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1118351978 14:64978731-64978753 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119420295 14:74504115-74504137 CAGGGAATCCAAAGCCAGGCTGG + Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119771748 14:77224485-77224507 CTGGGATCCCAGAAGGAAGCAGG + Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119826558 14:77661541-77661563 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1120312909 14:82854287-82854309 CAAGGAAGTCAGAGGGAGTCTGG - Intergenic
1121036168 14:90705454-90705476 CTGGGAACCCAGAGGCCGGGTGG - Intronic
1121781207 14:96623705-96623727 CAGGGACCCCGGATGGAGGCAGG + Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122232177 14:100311933-100311955 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1122529834 14:102417926-102417948 CAGGGGAGCCGCAGGGAGGCAGG + Intronic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1122879584 14:104684210-104684232 GAGGCAACCGAGAAGGAGGCTGG + Intergenic
1122907237 14:104807503-104807525 CAATGGCCCCAGAGGGAGGCAGG - Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123112424 14:105879634-105879656 CAGGGTGCCCAGGGGCAGGCAGG - Intergenic
1124233726 15:27968781-27968803 CAGGGAAACCACACAGAGGCGGG + Intronic
1124621333 15:31275784-31275806 CAGGGAACCCGGAGCGGGGTGGG - Intergenic
1125768481 15:42150282-42150304 GAGGGACCCAAGAGGGTGGCTGG - Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1125999270 15:44194616-44194638 CGGGGCGCCCGGAGGGAGGCGGG - Intronic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1126781214 15:52140362-52140384 GAGGGAGCACAGTGGGAGGCAGG - Intronic
1127265158 15:57355142-57355164 CAGGGAAACCAAGGGGAGCCCGG - Intergenic
1127850535 15:62908237-62908259 CAAGGAGCCCAGTGGGAGGTGGG - Intergenic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1128130949 15:65226685-65226707 AAGGGAACGCAGAGGCTGGCGGG - Intergenic
1128194017 15:65734456-65734478 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1128702575 15:69814940-69814962 CAAGGGACCAAGAGGGATGCAGG + Intergenic
1129294131 15:74590463-74590485 CAGAGGACCCAGAGAAAGGCAGG + Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129485805 15:75870997-75871019 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130403459 15:83578272-83578294 CAGGGGCTCCGGAGGGAGGCAGG - Intronic
1130894574 15:88160171-88160193 TGGGGAACCCAGAGGAAGGAGGG + Intronic
1130944569 15:88541354-88541376 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1131281434 15:91024485-91024507 CTGTGAACCCAGACCGAGGCAGG + Intergenic
1131917224 15:97281103-97281125 CAAGCAACCCAGAGGTAGTCAGG - Intergenic
1132387865 15:101413443-101413465 CAAGTAACCCACAGGAAGGCAGG + Intronic
1132435345 15:101796452-101796474 CAAAGAGCACAGAGGGAGGCTGG - Intergenic
1132440531 15:101860120-101860142 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1132544852 16:528262-528284 AGAGGAACCCAGAGGAAGGCGGG + Intronic
1132554908 16:568145-568167 CAGGGAGCCCAGGGGTTGGCGGG - Exonic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1132761519 16:1510733-1510755 CCGGGCACCCAGAGGCAGGTGGG + Exonic
1132958286 16:2608210-2608232 CAGTGAGCCCAGATAGAGGCGGG - Intergenic
1132973838 16:2701847-2701869 CTGGTGACCCGGAGGGAGGCAGG + Intronic
1133130982 16:3675995-3676017 CATGGATCCCAGAGTGAGCCTGG + Intronic
1133432941 16:5754531-5754553 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1133687362 16:8178904-8178926 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1133814087 16:9183206-9183228 CCAGGAAGCCAGAGGGAGTCGGG + Intergenic
1134235148 16:12459443-12459465 TAGGGAGCCCAGAGACAGGCTGG + Intronic
1134614888 16:15643256-15643278 CTGGGAACCCCGGGGGGGGCGGG + Exonic
1135328306 16:21541899-21541921 CAGGGCCCCCAGAGGAAGTCAGG + Intergenic
1135577919 16:23600278-23600300 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1136030015 16:27495938-27495960 CAGGGAACCAACAAGGAGGGTGG + Intronic
1136186422 16:28591267-28591289 AGGGCAACCCAGAGGGTGGCAGG - Intronic
1136930307 16:34412200-34412222 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1136974267 16:34999606-34999628 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1137366653 16:47865261-47865283 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1137674920 16:50299464-50299486 CAGGGGACCTAGAGGGGAGCGGG - Intronic
1138196810 16:55058129-55058151 CAGGGCACCCAGAGTGGAGCAGG + Intergenic
1138330956 16:56214869-56214891 CACCGGACCCAGAGGAAGGCTGG - Intronic
1138392924 16:56683280-56683302 CAGGGAACCCAGAGCTCTGCAGG + Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138503162 16:57461313-57461335 CCAGGACCCCAGAGGGAGACAGG + Intergenic
1138548062 16:57731091-57731113 GAGAGAACCCACTGGGAGGCTGG + Intronic
1138549696 16:57740655-57740677 CAGGGAACCAAGAGGCGGCCCGG - Intronic
1139599307 16:67976975-67976997 CAAGGAACCCAGAGGCAGGGTGG - Intronic
1139923680 16:70474406-70474428 GAGGAAACCCAGAGAGAGGTGGG + Intronic
1140418827 16:74799536-74799558 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1141079706 16:81039153-81039175 CAAGGAACCGGGAGGAAGGCTGG + Intronic
1141767759 16:86070101-86070123 CACCGAAGCCAGAGGGAGGCAGG + Intergenic
1142142406 16:88478533-88478555 CAGTGAGCCCTGCGGGAGGCAGG - Intronic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142314174 16:89333035-89333057 CAGGGAACCCCCAGGGAAGAAGG + Intronic
1142748716 17:1974646-1974668 CAGGGAAGCCAGGTGGAGACGGG + Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143096406 17:4480762-4480784 CAGGGAGCCCTGAGGTGGGCTGG - Intronic
1143195709 17:5074823-5074845 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1143620102 17:8075780-8075802 CAGGGCACCCTGGGGGAGGTGGG - Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144745441 17:17611071-17611093 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1144785701 17:17830553-17830575 CAGGGACCCCAGAGCCTGGCAGG + Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1145030983 17:19505101-19505123 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1145035886 17:19540287-19540309 CAGGTGGCCCACAGGGAGGCAGG + Intronic
1145269083 17:21394911-21394933 GAGGGACCCCTGAGGGTGGCAGG + Intronic
1145756917 17:27398949-27398971 CAGGGAACCCAGGTTGAGGGTGG - Intergenic
1145978690 17:28998777-28998799 CAGGGACCCCAGAGGCTTGCTGG + Intronic
1146181365 17:30700184-30700206 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1146839540 17:36140859-36140881 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1147384161 17:40071887-40071909 CTGGGTACCCAGAAAGAGGCTGG - Intronic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1148617709 17:49013514-49013536 CCGGGAAGCCAGGGAGAGGCTGG - Intronic
1148901663 17:50883216-50883238 CAGGGAAACCAGTAGGCGGCTGG - Intergenic
1148982082 17:51585851-51585873 GAAGGTACCCAGTGGGAGGCTGG - Intergenic
1149202419 17:54202376-54202398 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149629933 17:58114346-58114368 AAGGGAACCCAGGTGGAGCCAGG - Intergenic
1150124265 17:62626717-62626739 CAGGGAATCCGCAGAGAGGCAGG + Intergenic
1150233563 17:63573868-63573890 CAGGGAGCCCAGAGGGGAACAGG - Intronic
1150838732 17:68588378-68588400 CAGGGAACTGAGATGGAGACAGG + Intronic
1152021579 17:77782551-77782573 CAGGGAACCCACTGGCAGGCAGG + Intergenic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152228232 17:79102471-79102493 CAGGGCAGCCAAAGGGTGGCTGG - Intronic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152609021 17:81306621-81306643 CACGGTCCCTAGAGGGAGGCAGG + Intergenic
1152659156 17:81534504-81534526 CAGGAACCCCAGATGGAGCCCGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152748641 17:82052473-82052495 CAGGGACCCCCGAGCGAGGGAGG + Intronic
1152869521 17:82744673-82744695 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1152907754 17:82978193-82978215 AAGGGACCCCAGGAGGAGGCAGG - Intronic
1152925646 17:83086510-83086532 CAGGGCCCCCAGAGCAAGGCTGG - Intronic
1153422027 18:4917422-4917444 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1153915638 18:9741908-9741930 CCAGGGACCCAGAGGGAGCCAGG + Intronic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154355333 18:13620052-13620074 CTGGGAACCGAGGGTGAGGCTGG - Intronic
1154489910 18:14913352-14913374 CAAGCTACCCAGAAGGAGGCTGG + Intergenic
1155025198 18:21934718-21934740 CAGAGAGTCCACAGGGAGGCAGG - Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1156409581 18:36815056-36815078 CAGGTACACCAGATGGAGGCTGG + Intronic
1157241023 18:46009524-46009546 AAGGGAACTTAGAGGGTGGCAGG + Intronic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158544823 18:58387040-58387062 GAAGAAACACAGAGGGAGGCAGG - Intronic
1159484866 18:69042995-69043017 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1159519000 18:69495157-69495179 CAGGGAACGCAGTGGAAGCCTGG + Intronic
1159599589 18:70416206-70416228 CAGGGAACGGGGAGGGAGACAGG + Intergenic
1159670663 18:71216994-71217016 CAAGGAATCCAGATGGAGGGTGG - Intergenic
1160184564 18:76665482-76665504 CAAGTAACCCATAGGCAGGCAGG + Intergenic
1160219235 18:76960503-76960525 TAGGGAGACCAGAGGGAGCCTGG - Intronic
1160425066 18:78773726-78773748 CAGGGAACCCCTGGGCAGGCAGG + Intergenic
1160556032 18:79725843-79725865 CACGGAGCCCAGAAGGAAGCCGG - Intronic
1160556727 18:79730370-79730392 CAGGAAACCAGGAGGGAGACGGG - Intronic
1160675241 19:387472-387494 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161025002 19:2032659-2032681 CAGGGAGCCCTGAGGATGGCCGG + Intronic
1161210611 19:3063299-3063321 CAGGAAGGCCGGAGGGAGGCAGG + Intergenic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1161407238 19:4097498-4097520 AATGGAACCCAGAGTCAGGCAGG - Intronic
1161450883 19:4344598-4344620 CTGGGAAACCACAGGAAGGCCGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161545583 19:4878312-4878334 CAGGGAACAAAGAGGCAGCCGGG - Intergenic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162088496 19:8262470-8262492 CAGAGACCCCCGAGGGAGCCAGG + Intronic
1162149090 19:8632197-8632219 TAGAGGAGCCAGAGGGAGGCAGG + Intergenic
1162402511 19:10454491-10454513 CAGGGAGCCAATAGGGAAGCAGG - Intronic
1162463367 19:10826432-10826454 CAGGGAACCCGGGGCCAGGCGGG - Intronic
1162668078 19:12231972-12231994 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1162909805 19:13842738-13842760 GAGGGACCCAGGAGGGAGGCCGG - Intergenic
1163102031 19:15103637-15103659 CAGGGATCTCATAGGGAGGAGGG + Intergenic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1164122908 19:22284338-22284360 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1164153740 19:22575740-22575762 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1164370294 19:27637733-27637755 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164626731 19:29734269-29734291 CTGGAAACCCAGGGGGTGGCGGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164962528 19:32446290-32446312 CAGGTAACCTACAGGAAGGCAGG + Intronic
1165170763 19:33890118-33890140 CAGGGAAGCCATGGGGAGTCCGG + Intergenic
1165362039 19:35342673-35342695 AGGGGACCCTAGAGGGAGGCAGG - Intronic
1165595156 19:37006961-37006983 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1165634871 19:37332207-37332229 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1165655643 19:37529946-37529968 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1165691470 19:37866979-37867001 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1165832690 19:38737106-38737128 GAGGGAACCCGGAGGGTGGAGGG - Intronic
1165951375 19:39475583-39475605 CTGGGACCCCAGGGGGAGGTTGG + Intronic
1166142489 19:40812441-40812463 CAGGGGACCCAGAGGTGGCCCGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166319112 19:42005623-42005645 CAGGCACCCCCGAGGCAGGCTGG - Intronic
1166653706 19:44594898-44594920 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166812319 19:45522009-45522031 TAGGGAACCAAGAAGGGGGCTGG - Intronic
1167336641 19:48890438-48890460 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1167734277 19:51282351-51282373 CTGGCAACCCAGAGTGGGGCTGG - Intergenic
1167818899 19:51908334-51908356 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1167833188 19:52043935-52043957 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1167876856 19:52421100-52421122 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1167910455 19:52697883-52697905 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168695297 19:58400812-58400834 CAGGGCCCCCTGAGGGTGGCGGG - Intergenic
925302774 2:2828792-2828814 CAGGCAGACCAGAGGGAGACAGG + Intergenic
925575152 2:5352502-5352524 CAAGGAACCCAGAAGGAGAAAGG + Intergenic
926018491 2:9474679-9474701 CAGCGACCCCGCAGGGAGGCCGG - Intronic
926321210 2:11749426-11749448 AAGGGAACCCACAGGAAGGGAGG - Intronic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
927086108 2:19675331-19675353 TTGGGAACCCAGTGGAAGGCCGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927415235 2:22872431-22872453 GGGGGAACCTAGAGAGAGGCAGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927553530 2:24017776-24017798 GAAGGAACCCAGAAGGAGGCAGG - Intronic
927992901 2:27460781-27460803 AAGGGAACTCAGAGGCTGGCGGG + Intronic
928118219 2:28563354-28563376 GAGGGACCCCAGAGGGAGTGTGG + Intronic
928355979 2:30614920-30614942 CAGGAAGCCAAGAGGGAGGGAGG + Intronic
928539961 2:32275725-32275747 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
928767898 2:34670304-34670326 CAGGTAACCCAGAGAGACACCGG + Intergenic
928990299 2:37226120-37226142 AAGGGAACTCAGAGGCTGGCGGG + Intronic
929208169 2:39321964-39321986 AAGGGAACTCAGAGGCTGGCGGG + Intronic
929410644 2:41694725-41694747 AAGGAAACGCAGAGGGGGGCTGG + Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929942862 2:46348068-46348090 GAGGGAATCCAGTGTGAGGCTGG + Intronic
929946811 2:46377977-46377999 CACAGCACCCAGAGCGAGGCTGG + Exonic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930882855 2:56291888-56291910 TAGAGAGCCCAGTGGGAGGCTGG + Intronic
931464373 2:62473794-62473816 AAGGGATCACAGAGGGATGCTGG + Intergenic
932555157 2:72817525-72817547 CTGGGAACCCAAAGGGTGCCTGG - Intronic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934176861 2:89584626-89584648 TGGGGATCCTAGAGGGAGGCGGG - Intergenic
934188877 2:89767339-89767361 CAGGGAACCCATAGACAGGTAGG + Intergenic
934287168 2:91658986-91659008 TGGGGATCCTAGAGGGAGGCGGG - Intergenic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934606599 2:95699830-95699852 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936378455 2:111962986-111963008 AAGGGAACTCAGAGGCCGGCAGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
936487067 2:112935056-112935078 AAGGGAACTCAGAGGCCGGCGGG + Intergenic
936514519 2:113173577-113173599 CAGGGCACCCAGTGAGAGACAGG - Intronic
936540003 2:113341958-113341980 CTGGGAACCAGGAGGGAGGGAGG + Intergenic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937264618 2:120608003-120608025 CAGGGAACCCAGGGGGGCTCAGG + Intergenic
937295233 2:120806278-120806300 CAGGGAACCCAGAGGCACCCAGG - Intronic
937854301 2:126661312-126661334 CAGGGACCACAGAGCCAGGCAGG - Intronic
937912203 2:127081167-127081189 CACCGAACCCAGAAGGAGGAAGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938270048 2:129962108-129962130 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
938313585 2:130311269-130311291 CAGGGAATCCAGAGGGAGTGAGG - Intergenic
938732695 2:134158685-134158707 CAGGGCAGCCAGCGGGAGACGGG - Intronic
939983763 2:148811122-148811144 CAGGGAACCCAGAGGATGGCAGG - Intergenic
940089737 2:149902006-149902028 CAGGGAACTACGAGGAAGGCTGG - Intergenic
940786729 2:157989425-157989447 CAGGGAGCCCACAGAGAGGGGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
942247820 2:174023909-174023931 CAGGGAAGCCAGAGGCCGGGTGG - Intergenic
942320687 2:174733063-174733085 CATGGAACCCAGAGGGAAGACGG - Intergenic
942450092 2:176103923-176103945 TTGGGAACTCAGAGGGCGGCGGG + Intergenic
942868176 2:180700179-180700201 CCAGGAAGCCAGAGGGAGCCAGG - Intergenic
942944411 2:181657128-181657150 CAGGGACCCAGGAGGGAGGCGGG + Intronic
943314159 2:186365057-186365079 CAAGGAACCCTGAGGGATGTCGG - Intergenic
943655385 2:190503225-190503247 CAGGAAACCCAGAGGTTGGTAGG + Intronic
943838163 2:192542085-192542107 AAGGGAACTCAGAGGCCGGCAGG - Intergenic
944394913 2:199255587-199255609 AAGGGAACCAAGAGGGATGATGG - Intergenic
944497195 2:200319043-200319065 CAGGGAAGCTGCAGGGAGGCAGG - Intronic
944527270 2:200632176-200632198 CAGGCAACCCACAGGAAGGTGGG - Intronic
945175275 2:207037628-207037650 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
945417598 2:209594156-209594178 CAGGCATCCCAGAGGGAGTATGG + Intronic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
945832454 2:214803687-214803709 AAGGGAACTCAGAGGCTGGCGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946261336 2:218493779-218493801 CAGGCAACCCAGAAGAAAGCAGG - Intronic
946366202 2:219250606-219250628 CAGGCACCACAGTGGGAGGCTGG + Exonic
946369465 2:219271860-219271882 CAGGCACCACAGTGGGAGGCTGG - Intronic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
946780740 2:223191280-223191302 AAGGGAACTCAGAGGCTGGCGGG + Intronic
946896190 2:224327044-224327066 CAGGGAATCCAGAGAAGGGCTGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947273349 2:228363785-228363807 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
947488735 2:230575790-230575812 CAGGGAGCCCAGATGAATGCTGG - Intergenic
947520682 2:230843780-230843802 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
947634636 2:231673730-231673752 CAGGGAAGCAGGAGGGAGGTGGG - Intergenic
947638699 2:231693954-231693976 CAGAGACCCCACAGGCAGGCTGG - Intergenic
948596768 2:239084378-239084400 CAGGGAACCCTCAGTGATGCCGG + Intronic
948732844 2:239978063-239978085 CAGGGATCCCAGAGGCAGGGAGG - Intronic
948732858 2:239978120-239978142 CAGGGATCCCAGAGGCAGGGGGG - Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
948798953 2:240421509-240421531 CAAGGATCCCAGAGGGGGGATGG + Intergenic
948866441 2:240777456-240777478 CAGGAAACCCAGGGGGCTGCTGG - Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
948935139 2:241158986-241159008 GCGGGAACCCAAAGGGAGGCAGG - Intronic
949029511 2:241785610-241785632 ATGGGAACCCAAAGGGAGTCTGG + Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169791427 20:9414336-9414358 CATGGAACACAGAGGCATGCAGG - Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171451951 20:25242050-25242072 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1171464103 20:25315846-25315868 AAGGGAACACAGACAGAGGCAGG - Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172479439 20:35262267-35262289 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1172833300 20:37855333-37855355 GTGGGAACCCAGAAGAAGGCTGG - Intronic
1172846099 20:37930771-37930793 CAGGGCACCCAGGGTGAGGTGGG - Intronic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173260844 20:41433983-41434005 CATGTAAACCAGAGGAAGGCAGG + Intronic
1173319128 20:41971698-41971720 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1173747438 20:45448663-45448685 CAAGGAACCCAGTGGGGGGGTGG - Intergenic
1173884037 20:46441148-46441170 CAGGGCACCATGAGGGATGCTGG - Intergenic
1174447808 20:50602267-50602289 CAGGGAGCCCTGTGGCAGGCTGG + Exonic
1174452713 20:50629690-50629712 GAAGGAACCACGAGGGAGGCAGG - Intronic
1174484358 20:50851849-50851871 AGGGGACCCCAGAGGAAGGCTGG - Intronic
1175157941 20:56985883-56985905 CAGGGATGCTAGAGGGAGGGTGG - Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175196653 20:57248454-57248476 TAGGAAACCAAGAGGTAGGCAGG + Intronic
1175387358 20:58605862-58605884 GAGGGAAGCCAGAGTGAGCCCGG - Intergenic
1175583517 20:60119060-60119082 CAGGGAACACATAGGGGAGCTGG - Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175732597 20:61364253-61364275 CAGGGAACCCACATGGAAGCTGG + Intronic
1175824668 20:61930488-61930510 CAGGGATCCCAGTGGGAGGCAGG + Intronic
1176002579 20:62839674-62839696 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002597 20:62839722-62839744 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176002615 20:62839770-62839792 CAGGGCACCCAGGGAGAGGTGGG - Intronic
1176240299 20:64072821-64072843 CGGGGTCCCCAGAGGCAGGCTGG - Intergenic
1176375485 21:6085137-6085159 CTGGGAACCCTGGGGGAAGCAGG + Intergenic
1176424372 21:6538958-6538980 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1177175091 21:17694359-17694381 AAGGGAACTCAGAGGCCGGCGGG - Intergenic
1177296395 21:19181779-19181801 CAGGGAACCCAGGAGGGTGCTGG - Intergenic
1178355191 21:31905546-31905568 CAGGGAGCTCAGTGGGAGGTGGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179296314 21:40065956-40065978 CAGGAAACTCAGAGAGAGGTTGG - Intronic
1179444394 21:41421012-41421034 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1179608801 21:42535654-42535676 CAGGGAAGCCAGTGGCAAGCGGG - Intronic
1179699865 21:43147273-43147295 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179720908 21:43315599-43315621 CAGGCAGCCAGGAGGGAGGCTGG + Intergenic
1179747989 21:43453107-43453129 CTGGGAACCCTGGGGGAAGCAGG - Intergenic
1180157818 21:45986592-45986614 CAAGGAACCCTGTGGGGGGCTGG + Exonic
1180333084 22:11550461-11550483 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1180837794 22:18939476-18939498 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1180838703 22:18947683-18947705 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1180877132 22:19179782-19179804 CAGGGGACGCAATGGGAGGCAGG - Exonic
1181007900 22:20022783-20022805 CAGGGACCCCAGAAGGGGTCTGG + Intronic
1181386668 22:22550853-22550875 CAGCACTCCCAGAGGGAGGCAGG + Exonic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181525679 22:23484380-23484402 CAGGCAACCCACAGGGAGAGAGG + Intergenic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181560891 22:23698905-23698927 CTGGGAACCCACCGGGATGCTGG + Exonic
1181594899 22:23907884-23907906 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1181640049 22:24191518-24191540 CAGGAGACCTAGTGGGAGGCTGG - Intergenic
1181711828 22:24696064-24696086 CAGGCACCCCAGAGGGAGGGAGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182081693 22:27533911-27533933 CAGGGAACCCGCAGGGATGTGGG - Intergenic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182647320 22:31820821-31820843 CAGGGAACCCTGATGAAGGAGGG - Intronic
1183292420 22:37010830-37010852 GATGGAGCCCAGAGAGAGGCAGG + Intergenic
1183722852 22:39572402-39572424 CAGGGATGCCAGATGCAGGCTGG + Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
1184561193 22:45263800-45263822 CTGGGATCCCAGAGCAAGGCTGG + Intergenic
1184691722 22:46120285-46120307 CAGGGAGCCCAGAGCGAGGCTGG + Intergenic
1184826616 22:46956963-46956985 CAAGGAACCCAGGGAAAGGCTGG + Intronic
1185324395 22:50218642-50218664 CAGGCATCCCACAGGCAGGCAGG + Intronic
1203287885 22_KI270734v1_random:164775-164797 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
949360071 3:3222154-3222176 CAGGGAACCGAAGAGGAGGCAGG + Intergenic
949538862 3:5016771-5016793 CAGTGAACCCAGGGTGAGTCAGG + Intergenic
950030319 3:9847805-9847827 AAGGGAACTCAGAGGCTGGCGGG - Intronic
950319763 3:12040363-12040385 GATGGAAGCCAGAGTGAGGCAGG + Intronic
950573453 3:13816417-13816439 CTGGGAACCCACAGTGAGGGAGG + Exonic
950607052 3:14091328-14091350 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
950640257 3:14344054-14344076 CCGGGAGCCCAGGGGGAGGCTGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951514590 3:23544806-23544828 AAGGGAACTCAGAGGCTGGCGGG - Intronic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952932283 3:38369543-38369565 CAGGGAACCCAGAGCATGGGTGG - Intronic
952945768 3:38477186-38477208 CAGGCCACCCTGAGGGAGGGAGG - Intronic
953059878 3:39418442-39418464 AAGGGAACTCAGAGGCCGGCAGG - Intergenic
953481816 3:43258447-43258469 AAGGGAACTCAGAGGTCGGCGGG - Intergenic
953503447 3:43460196-43460218 CCTAGAACCCAGATGGAGGCAGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
953927395 3:46989401-46989423 AAGGGAACCCAGAGGAGGGTGGG + Intronic
953960147 3:47260336-47260358 AAGGGAACTCAGAGGCTGGCGGG + Intronic
954014008 3:47669871-47669893 CTGGGAACCCAGAGGGCACCAGG + Intronic
954040400 3:47882393-47882415 CAGGTAACCAACAGGAAGGCAGG - Intronic
954065762 3:48104661-48104683 CATAAAACCCCGAGGGAGGCTGG - Intergenic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
954440729 3:50520683-50520705 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
954688701 3:52384452-52384474 CAGGGCTCTCAGAGAGAGGCAGG + Intronic
954753706 3:52827731-52827753 CAGGCACCCTATAGGGAGGCTGG + Intronic
954869401 3:53756341-53756363 CTGCCAACCCAGAGGGAGGTGGG + Intronic
954896234 3:53977657-53977679 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956578976 3:70788757-70788779 CAGGTAACCCATAGGAAGGCAGG - Intergenic
956873696 3:73442112-73442134 CAGGGAACCCCCAGGGTGGCTGG - Intronic
957916452 3:86693693-86693715 GAGGGAACCAAGAGAGGGGCAGG - Intergenic
958937486 3:100272637-100272659 AAGGGAACTCAGAGGCTGGCGGG - Intronic
958975713 3:100666284-100666306 AAGGGAACTCAGAGGCTGGCGGG - Intronic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960027372 3:113024420-113024442 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
960028285 3:113032619-113032641 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
961210352 3:125120616-125120638 CAGGGAGCCCAGGGGAATGCTGG + Exonic
961335274 3:126172835-126172857 CAGTGAAGCCAGGGAGAGGCAGG + Intronic
961381628 3:126499480-126499502 CACAGGGCCCAGAGGGAGGCTGG + Intronic
961474138 3:127136402-127136424 CAGGGAACCCAGCCGCAGTCAGG - Intergenic
961484403 3:127207025-127207047 CAGGGCATCGAGAGGGAGCCAGG - Intergenic
961512531 3:127411796-127411818 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
961783484 3:129335389-129335411 CAGGGAACCCACTGGGAAGTTGG + Intergenic
961793488 3:129393159-129393181 CAGGCAACCAGGAGGTAGGCAGG - Intergenic
961807485 3:129499777-129499799 CAGGCAACCAGGAGGTAGGCAGG - Intronic
962454246 3:135550493-135550515 GAGGGAAGCAAGAGGCAGGCAGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963741480 3:149086223-149086245 CAGGGAACGCAGAGGAACGCGGG + Intronic
964447851 3:156779033-156779055 CAGGGAACCAAGAGGTAGGTGGG - Intergenic
966073293 3:175905693-175905715 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
966595155 3:181719429-181719451 CAGGGCAGCCGGCGGGAGGCCGG - Intergenic
966806241 3:183810010-183810032 CAGGGAGCACAGAGGTAAGCAGG - Intronic
967025801 3:185562691-185562713 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
967026712 3:185570903-185570925 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967179039 3:186887017-186887039 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
967179795 3:186894021-186894043 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
967418843 3:189251514-189251536 AAGGGAACTCAGAGGCTGGCGGG - Intronic
968095547 3:195927668-195927690 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
968221734 3:196944870-196944892 AAGGGAACTCAGAGGCCGGCGGG + Intergenic
968387180 4:151885-151907 AAGGGAACTCAGAGGCTGGCGGG - Intronic
968704619 4:2072164-2072186 CAGGGGACCCAGGGGCAGCCAGG + Exonic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
968836285 4:2966891-2966913 CAGGGACCAGAGAGGGAGGGGGG - Intronic
968969111 4:3784330-3784352 CAGGGAGCTCTGAGGGAAGCTGG - Intergenic
969397394 4:6931193-6931215 CAGACGACCCAGAGTGAGGCCGG - Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969439650 4:7209497-7209519 CCGGGACCCCAGCGTGAGGCTGG + Intronic
969465469 4:7353726-7353748 CAGGGAGCCCAGGGGCTGGCTGG + Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969576556 4:8039346-8039368 CAGGGAAGCCTGAGGAAGGCTGG - Intronic
969621634 4:8281675-8281697 CAGGGAACCCCGAGGGCTGTGGG + Intronic
970423435 4:15926003-15926025 CAGGGCACCCAGCTGGAGCCAGG - Intergenic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
970724227 4:19025025-19025047 GAGGGAACCCAGAAGTAGACTGG + Intergenic
972700954 4:41492421-41492443 GAGGGAGCCCAGAGGGAGAAGGG + Intronic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
974518022 4:62941680-62941702 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
975246773 4:72129367-72129389 AAGGGAACTCAGAGGCTGGCGGG - Intronic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
975662327 4:76700015-76700037 CAGGGAACCCATCAGGAAGCTGG + Intronic
975789523 4:77933434-77933456 CAGGGAACCCAGAAGTACGGGGG + Intronic
976431883 4:84971876-84971898 CTGAGAACCCAGAGGGGAGCTGG + Intergenic
977222659 4:94356134-94356156 CAGGGATCCTGGTGGGAGGCAGG + Intergenic
977269964 4:94905715-94905737 CATAGAAGCCAGAGGTAGGCAGG - Intronic
979141715 4:117183915-117183937 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
979245473 4:118499016-118499038 CATAGAACTCAGAGGAAGGCAGG + Intergenic
979322672 4:119342677-119342699 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
979327535 4:119397167-119397189 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
981001493 4:139833220-139833242 CCGGGAACCCAGAGAGGGGCTGG + Intronic
981582207 4:146261192-146261214 AAGGGGCCCCAGAGGAAGGCTGG + Intronic
982512789 4:156304905-156304927 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
982876656 4:160659588-160659610 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
983205395 4:164905657-164905679 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
983214555 4:164991185-164991207 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
984041752 4:174743968-174743990 CAGGCAAGCCAGAGGGCTGCCGG + Intronic
984328194 4:178280512-178280534 TAGACAACCCAGAGGGAGGCTGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
985087349 4:186326342-186326364 CAGGGAACCACGAGTGAGGGAGG - Intergenic
985128009 4:186714355-186714377 CCAGGAACCGAGAGGGAGACAGG + Intronic
985476522 5:82405-82427 CAGGGAGCTCAGTGGGAGCCTGG - Intergenic
985738020 5:1596120-1596142 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
986130549 5:4925731-4925753 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
986277232 5:6287199-6287221 CAGGGAATCCAAAGGGGAGCAGG + Intergenic
986549685 5:8938543-8938565 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
986602734 5:9489461-9489483 CAGGGCACCCACAGGGATGGCGG + Intronic
986662790 5:10074236-10074258 CGGGGAACCCACAGGTAAGCAGG + Intergenic
987022668 5:13890519-13890541 CTGGGAATCCTGAGAGAGGCAGG - Intronic
988379927 5:30486796-30486818 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
988380851 5:30495292-30495314 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
988497710 5:31758910-31758932 CAGGGAACGCATGTGGAGGCGGG - Intronic
988850664 5:35177188-35177210 AAGGGAACTCAGAGGCTGGCGGG + Intronic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989737860 5:44730630-44730652 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
990028923 5:51231771-51231793 GAGGCAACCCAGAAGGAGTCTGG - Intergenic
990414351 5:55571874-55571896 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
990789809 5:59464589-59464611 AAGGGAACTCAGAGGCTGGCGGG + Intronic
991017194 5:61944980-61945002 CAGGTAACACAGAGGAAAGCTGG + Intergenic
991976661 5:72189842-72189864 CAGGGAACTCAGAGTCGGGCTGG + Intronic
992320145 5:75605976-75605998 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
994458279 5:100042690-100042712 TAGGGAACCCAAAGGGATTCTGG + Intergenic
995878915 5:116821933-116821955 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
996614371 5:125422734-125422756 CATGGAAGGCAGAGGGAGGTGGG - Intergenic
997583553 5:135031613-135031635 CAGGAACCCTAGAGGGAGGGAGG - Intronic
998675459 5:144403086-144403108 CAAGAACCCAAGAGGGAGGCAGG - Intronic
999951645 5:156657849-156657871 AAGGGAACTCAGAGGCTGGCGGG - Intronic
999952549 5:156666061-156666083 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1000819250 5:165963361-165963383 GAGGGACCCAAGAGGGAGGGAGG - Intergenic
1001232046 5:169997018-169997040 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1001321617 5:170687018-170687040 CAGGGAACTCAGGGGGAGAATGG - Intronic
1001513024 5:172336979-172337001 CAGCGGTCCCATAGGGAGGCAGG - Exonic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1001677409 5:173530127-173530149 CAAGAAGCCCAGAGGCAGGCAGG - Intergenic
1001801935 5:174552075-174552097 GAGCGAACCCAGATGGAGTCGGG - Intergenic
1001875261 5:175194824-175194846 CAGGCAGCCCAGAAGGAGGGAGG + Intergenic
1002101692 5:176861067-176861089 TAGGGATGGCAGAGGGAGGCTGG - Intronic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002446028 5:179290692-179290714 CAGAGAGCACTGAGGGAGGCTGG - Intronic
1002482740 5:179514106-179514128 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1002666303 5:180828067-180828089 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003124674 6:3346733-3346755 CAGGGAACCAAGTGGAAGGTGGG - Intronic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004956482 6:20733090-20733112 CAGGGACCTCAGTGGGAGTCAGG + Intronic
1005699702 6:28388129-28388151 CAAGGAACCCAGAGTGAGTCTGG - Intronic
1006180258 6:32150053-32150075 CTGGGAACCAAGAGGGATGTGGG - Intronic
1006294508 6:33164168-33164190 CAGGGCACCCAGGGGGAGCAGGG - Intronic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006397455 6:33796596-33796618 CAGGGAGCCCGGTGGGAGGCAGG - Intronic
1006399719 6:33810103-33810125 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1006505481 6:34486178-34486200 CTGGGAACCCAGGGAGAGGGAGG + Intronic
1006538398 6:34719603-34719625 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1006682902 6:35810144-35810166 AAGGGACCCCAGAGGGGAGCGGG - Intronic
1007109269 6:39303676-39303698 CATGGACCCCGGAGGGAGGCGGG + Intronic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1007655735 6:43450068-43450090 CAGGGACCTCCGAGTGAGGCAGG - Exonic
1007793468 6:44328191-44328213 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1008583047 6:52923475-52923497 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008730123 6:54472105-54472127 TAGGGAACTCAGAGGAAGTCAGG - Intergenic
1010374995 6:75157597-75157619 AGGGGAATCCAGATGGAGGCTGG + Intronic
1010591399 6:77717088-77717110 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1010592336 6:77725550-77725572 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1010686475 6:78859590-78859612 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1012458202 6:99430173-99430195 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012925338 6:105261832-105261854 CAGGGGATCCAGAGTGGGGCAGG - Intergenic
1013555728 6:111255241-111255263 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1014800773 6:125775990-125776012 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1015042142 6:128733890-128733912 CAGGAAATTCAGAGGAAGGCTGG + Intergenic
1015574722 6:134659253-134659275 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1015878182 6:137845182-137845204 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1017171054 6:151455353-151455375 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1017791721 6:157805474-157805496 CTGGGAGCCCACATGGAGGCAGG - Intronic
1018024620 6:159794874-159794896 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019417879 7:935543-935565 CAGGGACCCCGGAGGGAGGGTGG + Intronic
1019540857 7:1550399-1550421 CAGGGAGCACAGAGGGGGACCGG + Intronic
1019608238 7:1920993-1921015 CAGGCAACCCAAAGAGAGGGTGG + Intronic
1019676177 7:2314102-2314124 CAGGGGACCCCGAGGGACGGAGG + Intronic
1019907398 7:4075103-4075125 CAGAGACCCCAAAGGCAGGCAGG + Intronic
1019976073 7:4582569-4582591 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1019977007 7:4591073-4591095 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1019977943 7:4599576-4599598 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1020280260 7:6646702-6646724 CAGGGAGCACTGGGGGAGGCGGG - Intronic
1020461178 7:8432160-8432182 CTGGGAATCCAGATAGAGGCAGG + Intergenic
1021067844 7:16198524-16198546 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1021121468 7:16800569-16800591 CACAGAAGCCAGAGTGAGGCTGG - Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021671651 7:23040658-23040680 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1022164247 7:27741797-27741819 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1022448522 7:30491722-30491744 CAAGTAACCCACAGGAAGGCAGG - Intergenic
1022505676 7:30907583-30907605 CAGAGAACCCTGATGGAGGGTGG - Intergenic
1022517484 7:30985113-30985135 CAGAGACCCCAGAGGGCGGGTGG - Intronic
1023049546 7:36239241-36239263 CACACAACCCAGAGGGAGCCAGG - Intronic
1023181883 7:37492739-37492761 CTGGGAACCCACTGGGAGGGAGG + Intergenic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1023623615 7:42095902-42095924 GAGGAAACCTGGAGGGAGGCTGG + Intronic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1024094221 7:45971687-45971709 CAGGGAGCAGGGAGGGAGGCAGG - Intergenic
1024123828 7:46271381-46271403 CTGAGAACCCAGAGGGAGAGGGG - Intergenic
1024617863 7:51130654-51130676 GAGGACACCCAGGGGGAGGCAGG - Intronic
1025850911 7:65243177-65243199 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027113004 7:75455675-75455697 CGGGGACCCCAAAGGGAGGGTGG - Intronic
1027285251 7:76640286-76640308 CGGGGACCCCAAAGGGAGGGTGG - Intergenic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029283064 7:99449117-99449139 CAGGGAGCCCGGCAGGAGGCTGG + Intronic
1029534702 7:101149996-101150018 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1030081525 7:105782670-105782692 CAGGGAACGCAGAGAGATACTGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030735533 7:113043495-113043517 CAGGGAGCCCAAGGGGAGGGAGG + Intergenic
1030760242 7:113341661-113341683 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1031607046 7:123781439-123781461 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1031657199 7:124372505-124372527 AACGGAAGCCAGAGAGAGGCAGG + Intergenic
1031724536 7:125221313-125221335 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1032077357 7:128842408-128842430 CAGGGGTCCCTGAGGGAGGGCGG + Intronic
1032085238 7:128880292-128880314 CAGGCATCAGAGAGGGAGGCTGG - Intronic
1032215359 7:129952948-129952970 CACGGCGCCCAGAGCGAGGCTGG - Exonic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032551404 7:132787489-132787511 CAGGGAAGTCAGTGGGAGCCTGG + Intronic
1033212186 7:139468208-139468230 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1033349824 7:140553127-140553149 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1034324780 7:150220520-150220542 CTGGGACCCCGGAGGGAAGCCGG + Intergenic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034768411 7:153748711-153748733 CTGGGACCCCGGAGGGAAGCCGG - Intergenic
1034900044 7:154902533-154902555 TCAGGAACCCAGAGGGAGGAGGG - Intergenic
1035349721 7:158237593-158237615 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1035614036 8:989229-989251 CTGGGAACCCAGAGGGACTCCGG - Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036291621 8:7498018-7498040 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1036292553 8:7506521-7506543 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037429509 8:18794751-18794773 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1037507980 8:19551499-19551521 CAGTGAACCGACAGGGAGACAGG - Intronic
1037745976 8:21644407-21644429 CTGGGAAGGCAGAGAGAGGCTGG - Intergenic
1037754560 8:21702680-21702702 CAGGGACCCAAGAGGCAGGGAGG - Intronic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1039079663 8:33722467-33722489 CAGAGACCCCAGAGAGAGCCAGG + Intergenic
1039392584 8:37193511-37193533 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1039871539 8:41549997-41550019 AAGGAAGCTCAGAGGGAGGCAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040126100 8:43739682-43739704 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1040413243 8:47176176-47176198 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1040484886 8:47860493-47860515 ATGGGAACCCACAGTGAGGCTGG + Intronic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1041060685 8:54031824-54031846 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1041374487 8:57199746-57199768 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1041768573 8:61447467-61447489 CAAGTAACCCAGAAGAAGGCAGG - Intronic
1041896103 8:62926368-62926390 CAGTAAACCCACAGGGGGGCTGG - Intronic
1042021311 8:64373230-64373252 GAGAGAACGCAGAGGGAGGGAGG + Intergenic
1042875206 8:73435202-73435224 TTAGGAACCCAGAGGGAGGCAGG - Intronic
1042894512 8:73651605-73651627 CAGAGACCCCAGAAGGAGCCAGG - Intronic
1044310235 8:90684834-90684856 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1044310367 8:90685681-90685703 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1045481964 8:102600134-102600156 CAGGGAAGGCAGAGGGAAGTAGG - Intergenic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1046400103 8:113694081-113694103 CATGGAAGCCAGAAGGAGGTGGG - Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048947154 8:139460049-139460071 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1049199877 8:141334805-141334827 CCGGGCACCCAGCAGGAGGCTGG - Intergenic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049477278 8:142802588-142802610 CAGGGAAGCCAGAGGCAGCTGGG + Intergenic
1049556956 8:143287427-143287449 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049590269 8:143456206-143456228 CAAGTAACCCATAGGAAGGCAGG + Intronic
1049610376 8:143552481-143552503 CAGGGACCCCAGAAGGGGACAGG + Intergenic
1049663692 8:143832791-143832813 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1049701173 8:144013510-144013532 CAGGGAACCCAGTGGGTAGGGGG - Intronic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1049845084 8:144796696-144796718 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1051471345 9:17446163-17446185 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1052016646 9:23476079-23476101 CCAGGAACCCAGAGGCAGGAAGG - Intergenic
1052279311 9:26715294-26715316 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1052676520 9:31633022-31633044 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1053070164 9:35096429-35096451 TAGGGTGCCCAGCGGGAGGCTGG - Exonic
1053476330 9:38384548-38384570 AAGGAAGCCCAGAGGGAAGCAGG - Intergenic
1054322179 9:63681752-63681774 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1054843052 9:69763280-69763302 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1054941980 9:70753543-70753565 GAGGGAACCCAGATGGGAGCAGG + Intronic
1055062989 9:72090195-72090217 CTGAGAACCCAGAGGGGCGCTGG - Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055729830 9:79268982-79269004 CAGGGAACACAGAGCATGGCAGG - Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056047751 9:82736808-82736830 CAGAAAACCCAGAGGCAGGTGGG + Intergenic
1056665296 9:88576785-88576807 CAGAGAACCCAGAGGAAAGCAGG - Intronic
1057020512 9:91693722-91693744 GAGGGAACCAGGAGTGAGGCAGG + Intronic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1057461819 9:95269914-95269936 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1058806312 9:108595407-108595429 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1059312983 9:113401211-113401233 CCGGGAGCCCTTAGGGAGGCAGG - Exonic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1060167425 9:121429908-121429930 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1060269688 9:122131853-122131875 CAGGAAGCCCAGCGGGTGGCCGG - Intergenic
1061211813 9:129198084-129198106 CAGACGACCCTGAGGGAGGCAGG + Intergenic
1061400869 9:130367643-130367665 TAAGGATCCCAGGGGGAGGCTGG + Intronic
1061554312 9:131357513-131357535 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1061855356 9:133439115-133439137 GGGGCAAGCCAGAGGGAGGCAGG - Intronic
1061859543 9:133460791-133460813 CAGAGGACCCAGGGAGAGGCCGG - Intronic
1061894117 9:133638092-133638114 TAGGGAAGCCAGAGGAAGCCAGG + Intronic
1061955340 9:133958576-133958598 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1061979448 9:134092579-134092601 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1062295814 9:135825936-135825958 CAGGGAGCCCGGGGGGAAGCTGG + Intronic
1062533593 9:137012101-137012123 CAGGTAATCCAGGGAGAGGCTGG + Exonic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1185790502 X:2925326-2925348 TAGGGCCCCCAGAGGGAGCCCGG + Intronic
1186361963 X:8851782-8851804 TCAGGAAACCAGAGGGAGGCCGG + Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1187198806 X:17115154-17115176 AAGGGAACTCAGAGGCTGGCAGG - Intronic
1187515775 X:19968562-19968584 CACGGGACCCAGAGGGTGGGGGG + Intronic
1187768661 X:22670944-22670966 CAGGGGACCCAAAGGGTGTCTGG + Intergenic
1187933950 X:24318090-24318112 CAGGGATCACAAAGGGAAGCTGG + Intergenic
1188141611 X:26558134-26558156 CAGAGACCCCAGAAGGAGCCAGG - Intergenic
1189089881 X:38070509-38070531 GAGAGAAACCAGAGGTAGGCAGG - Intronic
1189428509 X:40925735-40925757 CAAGTAACCCATAGGAAGGCAGG - Intergenic
1189720986 X:43917415-43917437 GAGGGAACCCAGATGAAGCCTGG - Intergenic
1190214420 X:48470222-48470244 GGGGGCCCCCAGAGGGAGGCAGG + Intronic
1190334283 X:49253034-49253056 GAGGGCACTCAGAGGGAGACAGG + Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1192120244 X:68448499-68448521 CAGTGAACCCAGAGGTAGAGAGG + Intergenic
1192212488 X:69136817-69136839 TAGGGCACCCAGAAGGAAGCAGG + Intergenic
1192561822 X:72132231-72132253 CAAGGTACCGAGAGGGAGGGGGG + Intergenic
1195066843 X:101245013-101245035 CAGGGAACCTGGACAGAGGCTGG - Exonic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195677981 X:107522057-107522079 CAGGGCATCTAGAGGGAGCCAGG + Intergenic
1197369306 X:125606742-125606764 AAGGGAGCCCAGATGGAGGGTGG - Intergenic
1197383912 X:125780313-125780335 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1197893768 X:131289472-131289494 CAGGGAGTCCGGAGAGAGGCGGG - Intronic
1198297624 X:135302880-135302902 AAGGGAACTCAGAGGCCGGCGGG - Intronic
1198308635 X:135406901-135406923 AAGGGAACTCAGAGGCCGGCGGG + Intergenic
1199256158 X:145720984-145721006 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1199512700 X:148640391-148640413 CACAGAAGCCAGAGGGAGGGAGG - Intronic
1199629120 X:149763622-149763644 TAGGGAACCCACAGGGAGATGGG - Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1202253092 Y:22893182-22893204 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1202406082 Y:24526931-24526953 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1202464700 Y:25143150-25143172 AAGGGAACTCAGAGGCTGGCGGG + Intergenic