ID: 914457006

View in Genome Browser
Species Human (GRCh38)
Location 1:147845654-147845676
Sequence GTGTGCAAAGGGCCCTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914457000_914457006 19 Left 914457000 1:147845612-147845634 CCTGACATAAGCATAACTGAGGC No data
Right 914457006 1:147845654-147845676 GTGTGCAAAGGGCCCTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914457006 Original CRISPR GTGTGCAAAGGGCCCTTCTA GGG Intergenic
No off target data available for this crispr