ID: 914457110

View in Genome Browser
Species Human (GRCh38)
Location 1:147846308-147846330
Sequence CTGTCCTGCCTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914457101_914457110 14 Left 914457101 1:147846271-147846293 CCAAGGTCAAAAGCAACTGCTCC No data
Right 914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG No data
914457100_914457110 18 Left 914457100 1:147846267-147846289 CCTTCCAAGGTCAAAAGCAACTG No data
Right 914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG No data
914457102_914457110 -7 Left 914457102 1:147846292-147846314 CCCCTCCATTTCCCAGCTGTCCT No data
Right 914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG No data
914457104_914457110 -9 Left 914457104 1:147846294-147846316 CCTCCATTTCCCAGCTGTCCTGC No data
Right 914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG No data
914457098_914457110 29 Left 914457098 1:147846256-147846278 CCAGCACACCACCTTCCAAGGTC No data
Right 914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG No data
914457099_914457110 21 Left 914457099 1:147846264-147846286 CCACCTTCCAAGGTCAAAAGCAA No data
Right 914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG No data
914457103_914457110 -8 Left 914457103 1:147846293-147846315 CCCTCCATTTCCCAGCTGTCCTG No data
Right 914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914457110 Original CRISPR CTGTCCTGCCTGGGAAAAAC AGG Intergenic
No off target data available for this crispr