ID: 914463027

View in Genome Browser
Species Human (GRCh38)
Location 1:147902387-147902409
Sequence TGGGAGAATCTTAATGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914463027_914463030 -4 Left 914463027 1:147902387-147902409 CCTACATCATTAAGATTCTCCCA No data
Right 914463030 1:147902406-147902428 CCCAGCTGATGATAAGGCCTTGG No data
914463027_914463035 25 Left 914463027 1:147902387-147902409 CCTACATCATTAAGATTCTCCCA No data
Right 914463035 1:147902435-147902457 GCCCCTAGGCTCATGCGCTCTGG No data
914463027_914463032 -3 Left 914463027 1:147902387-147902409 CCTACATCATTAAGATTCTCCCA No data
Right 914463032 1:147902407-147902429 CCAGCTGATGATAAGGCCTTGGG No data
914463027_914463033 11 Left 914463027 1:147902387-147902409 CCTACATCATTAAGATTCTCCCA No data
Right 914463033 1:147902421-147902443 GGCCTTGGGAAAATGCCCCTAGG No data
914463027_914463028 -10 Left 914463027 1:147902387-147902409 CCTACATCATTAAGATTCTCCCA No data
Right 914463028 1:147902400-147902422 GATTCTCCCAGCTGATGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914463027 Original CRISPR TGGGAGAATCTTAATGATGT AGG (reversed) Intergenic
No off target data available for this crispr