ID: 914464772

View in Genome Browser
Species Human (GRCh38)
Location 1:147917157-147917179
Sequence CACAACTACCAAGTTAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914464771_914464772 -4 Left 914464771 1:147917138-147917160 CCACTCATTCACATGGCTGCACA No data
Right 914464772 1:147917157-147917179 CACAACTACCAAGTTAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914464772 Original CRISPR CACAACTACCAAGTTAATGC TGG Intergenic
No off target data available for this crispr