ID: 914465674

View in Genome Browser
Species Human (GRCh38)
Location 1:147926337-147926359
Sequence CTGGGGACTCAGAGCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 2, 1: 1, 2: 2, 3: 45, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914465669_914465674 -4 Left 914465669 1:147926318-147926340 CCCTTGGAAAAAGCACAAACTGG 0: 2
1: 0
2: 1
3: 17
4: 334
Right 914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG 0: 2
1: 1
2: 2
3: 45
4: 407
914465671_914465674 -5 Left 914465671 1:147926319-147926341 CCTTGGAAAAAGCACAAACTGGG 0: 2
1: 0
2: 2
3: 28
4: 218
Right 914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG 0: 2
1: 1
2: 2
3: 45
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914465674 Original CRISPR CTGGGGACTCAGAGCCCAGA TGG Intergenic
900266448 1:1759648-1759670 CCAGAGACACAGAGCCCAGAGGG + Intronic
900607997 1:3532286-3532308 CTGGGGACTCTGATCCAAGCCGG - Intronic
900994344 1:6112393-6112415 CAGGGGACTCGCTGCCCAGAAGG + Intronic
901220806 1:7582831-7582853 CTGGGGACTGAGGAACCAGAAGG + Intronic
901923469 1:12552042-12552064 CTGGGGACCCAGGTCCCAGCAGG + Intergenic
902409780 1:16206084-16206106 CTGAGGAGTCAGAGCCAGGATGG + Intronic
902880637 1:19369844-19369866 CTGCGGACTCAGAGCCCCACTGG - Intronic
902941010 1:19800050-19800072 CTGGCGAGTCAGAGCCTGGAAGG - Intergenic
903479805 1:23645007-23645029 CTGGGGACTGAGAGCCAAGCAGG - Intergenic
904371915 1:30053282-30053304 GTAGGGACTCAGAGTCCAGATGG + Intergenic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904598899 1:31663114-31663136 TTGGGGAATCAGAGCCCACATGG - Intronic
905210267 1:36369345-36369367 CTGGGCAATCAGATCCCAGGAGG + Intronic
905449462 1:38047159-38047181 CTGGAGACTCCGAGCCCGGCCGG + Intergenic
905793810 1:40804094-40804116 CTGCTGACTCAGAGGACAGAAGG + Intronic
906575408 1:46885018-46885040 ATGGGGACTCAGAGAAAAGATGG - Intergenic
906596568 1:47082877-47082899 ATGGGGACTCAGAGAAAAGATGG + Intronic
907283050 1:53363232-53363254 GAGGGGACTCAGTACCCAGAGGG - Intergenic
907321457 1:53605358-53605380 CTGGGCTCTGAGGGCCCAGAGGG - Intronic
907574231 1:55511484-55511506 CTTGGAACACAGAGCACAGATGG + Intergenic
907629029 1:56061513-56061535 ATGAGGAATTAGAGCCCAGAGGG - Intergenic
907944655 1:59124341-59124363 CTGGGGAGACAGACCCAAGAAGG - Intergenic
910853491 1:91671080-91671102 CTTGGCACTCAGAGCCCTAAGGG - Intergenic
912138932 1:106697446-106697468 GTGGGAACACAGAGCCCAAAAGG - Intergenic
912201252 1:107460897-107460919 ATCGGGTCTTAGAGCCCAGAAGG + Intronic
912315127 1:108661244-108661266 CTTGGAACTGAGAGCCTAGAGGG - Exonic
913280883 1:117184010-117184032 CTGGGGACTCACTGCCAAGTAGG + Intronic
913296815 1:117329600-117329622 GTGGGATGTCAGAGCCCAGATGG + Intergenic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
915110408 1:153561237-153561259 CAGGAGAGTCAGAGCCCAGAAGG + Exonic
915637925 1:157199337-157199359 CTGGGAACCAAGAACCCAGAGGG + Intergenic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
916608242 1:166363938-166363960 ATAGGGAATCAGAGCCCAGGTGG - Intergenic
917953291 1:180064068-180064090 TTGGGGAGTCAGAGCCCAGGTGG - Intronic
918317013 1:183330877-183330899 CTGGGAGCTCTGAGCCCTGAAGG - Intronic
918863263 1:189860480-189860502 CTGGGGCCTGAGATCCCAGGAGG + Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919094314 1:193011385-193011407 CTGAGTACTCAGAACACAGATGG + Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
923024091 1:230190604-230190626 TCAGGGAGTCAGAGCCCAGAGGG - Intronic
924907771 1:248474374-248474396 CTGGGGACCCGGAGACCTGAGGG - Intergenic
924916338 1:248573712-248573734 CTGGGGACCCGGAGACCTGAGGG + Intergenic
1062845111 10:697536-697558 CTCGGGAATCTGACCCCAGATGG + Intergenic
1063351746 10:5362877-5362899 CTGGCATCTCAGAGCCCATAAGG + Intergenic
1063629872 10:7723362-7723384 CTGGGGACTCAGAGAAGAGAGGG - Intronic
1067084053 10:43228951-43228973 GTGGGCACTCAGAACCCAGGGGG + Intronic
1069614272 10:69796942-69796964 CTGGGAACTCACAGCTCAGGAGG + Intergenic
1069679909 10:70277147-70277169 CTGGGGAGGCAGAGGCCAGATGG - Intronic
1069849897 10:71397720-71397742 ATGGGGACCCAGGGCTCAGAAGG - Intronic
1069871092 10:71533574-71533596 CTGGGGCTGCAGAGGCCAGAAGG + Intronic
1070127581 10:73634565-73634587 CTCCAGACCCAGAGCCCAGATGG + Exonic
1070808877 10:79287278-79287300 TTGGAGACTGGGAGCCCAGAGGG - Intronic
1070816171 10:79324926-79324948 CTGGGGACTCAGAGACTCCAGGG + Intergenic
1070917799 10:80165993-80166015 GTGTGGACACACAGCCCAGAAGG - Intronic
1071497607 10:86179594-86179616 CTGGGGACCCAGGGAGCAGAAGG - Intronic
1071601967 10:86962756-86962778 CTGGGCTCCCAGGGCCCAGAGGG + Intronic
1071666659 10:87564725-87564747 CTGGGGACTGAGATCCCTCATGG - Intergenic
1072249549 10:93570694-93570716 CTGGGCACCCACAGCCCACATGG - Intronic
1072555407 10:96511036-96511058 CTGTGGACTCAGAATGCAGAGGG - Intronic
1073098858 10:100996920-100996942 CTGTGAAGTCAGAGGCCAGAGGG + Intronic
1073320587 10:102613932-102613954 CTGGGGCCTTAAAGCCCAGCAGG + Intronic
1074738242 10:116458706-116458728 GGGGGAACTCAGAGCACAGATGG - Intronic
1075114900 10:119618069-119618091 CTGAGGAACCTGAGCCCAGAGGG - Intergenic
1077438145 11:2554572-2554594 CTGGGGAGGCAGTGCCCAGTGGG - Intronic
1078479676 11:11664864-11664886 AGGTGGAATCAGAGCCCAGAAGG - Intergenic
1078845143 11:15113715-15113737 CTGGGGGCCCAGGGCTCAGAAGG - Intronic
1080089909 11:28335302-28335324 CTGGGGACTCAGAAAACCGAGGG + Intergenic
1080110914 11:28566839-28566861 CGGGTGACTCAGAGCGCAGGAGG + Intergenic
1080447831 11:32353521-32353543 CTGGGACCTAAGAGCCAAGAGGG - Intergenic
1081606955 11:44533103-44533125 ATGGGGACGCTGAGGCCAGAGGG - Intergenic
1081656864 11:44863114-44863136 TTGGGGGTTCAGAGGCCAGAAGG + Intronic
1082117704 11:48345587-48345609 CTGAGGACTCATAGCTCTGAAGG - Intergenic
1082923760 11:58524043-58524065 CTGGGAACACAGAGCTCAGTGGG - Intergenic
1083322864 11:61857838-61857860 CATGGGACTCAGGGCCCACAGGG - Intronic
1083475132 11:62910407-62910429 CTGGCGTCTCGGAGCCCTGAAGG + Exonic
1083597822 11:63927591-63927613 CTGGAGGCTGTGAGCCCAGAGGG + Intergenic
1083610748 11:64003046-64003068 CTGGGGAGGCAGAGCCCACTTGG + Intronic
1084013517 11:66365712-66365734 CTGGGGACACAGAGGTCAGCTGG + Intronic
1084113777 11:67030168-67030190 CTGGGCACTCACCGCTCAGATGG - Exonic
1084567608 11:69940292-69940314 CTGGGGACCCAGAGCACCCAAGG + Intergenic
1085410444 11:76287582-76287604 CTGGGGCCTGAGAACCCAGCAGG + Intergenic
1087400993 11:97667162-97667184 CTGGGCACTCTGAGTGCAGAGGG - Intergenic
1089040671 11:115446334-115446356 CTGTGGACTCAGACCCAAAAGGG - Intronic
1090183255 11:124718953-124718975 CTGGGGGCACAGGGTCCAGACGG - Intergenic
1090396650 11:126423807-126423829 CTGGGGTCACACAGCCCAGGAGG + Exonic
1091215429 11:133898570-133898592 CTGGGGATAGAGGGCCCAGAAGG - Intergenic
1091316164 11:134615484-134615506 AGGGGCCCTCAGAGCCCAGAGGG - Intergenic
1091782806 12:3224601-3224623 CTGGGGAAGCTGTGCCCAGAGGG + Intronic
1091823457 12:3492590-3492612 CTCGGGACGCAAAGCCCAGCAGG - Intronic
1094086057 12:26593025-26593047 CAGGAAACTCAGGGCCCAGAGGG + Intronic
1096001629 12:48135086-48135108 CAGGAGACTCAGAAGCCAGAAGG - Intronic
1096077611 12:48815029-48815051 CTGGAGACACAGAGCCGAGCCGG + Intronic
1097232835 12:57522795-57522817 CTGGGGATTCCGTTCCCAGAAGG - Exonic
1100390464 12:94142333-94142355 CTGGGGACTAAGGGTTCAGAAGG - Intergenic
1100867040 12:98868146-98868168 CTGGACACTCAGAGTCTAGAAGG + Intronic
1102146971 12:110661486-110661508 TTGGCCACTCAGAGCCCACATGG + Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103049817 12:117769281-117769303 CTGGAGATTCAGAGATCAGATGG - Intronic
1103549833 12:121728853-121728875 ATGGGGACCCAGAGCTCATAGGG - Intronic
1104947563 12:132423449-132423471 CAGGCGACCCAGAGCCGAGACGG + Intergenic
1105750887 13:23420913-23420935 CTGGGGCCTCAGTGCCCACTTGG + Intronic
1106420952 13:29585709-29585731 CTTGGGATTCAGAGCCCTGTTGG - Intronic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1106942226 13:34791906-34791928 CTGAGGACTGAGAGACTAGAAGG + Intergenic
1110485466 13:76036477-76036499 CTGTGGAAACAGAGCCCATATGG - Intergenic
1110760276 13:79223458-79223480 CTGAGGTCTCACAGCCCAAATGG - Intergenic
1110817281 13:79876114-79876136 GTGAGGACTGAAAGCCCAGAAGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111343753 13:86922854-86922876 CTGGAGCCTCAGAGCTTAGATGG - Intergenic
1113376197 13:109766805-109766827 CAGGGGAGTCAGAGCCAAGGTGG - Intronic
1113766327 13:112882979-112883001 GTGGGGACGCAGAGCCCGGCGGG - Exonic
1113777296 13:112955098-112955120 CTGGGGACTCAGGGACCCGAGGG + Intronic
1113883079 13:113639670-113639692 GCGGGGACTGAGAACCCAGAGGG - Intronic
1113930736 13:113967656-113967678 CTGGGGTCTCAGGGCCCTGATGG - Intergenic
1114619153 14:24084633-24084655 CTGTGGGCACAGAGCCCAAAGGG + Intronic
1117377538 14:55129624-55129646 CTGGGGCCGCAGAGCGCAGGCGG - Intronic
1119543689 14:75456906-75456928 CTGGGGACTCAGGACCAAGAGGG - Intronic
1119666470 14:76488676-76488698 CTGGGAACTCAGAGCTGGGATGG + Intronic
1120363896 14:83541329-83541351 CCAGGGACTCAGAGCCTCGAGGG + Intergenic
1122421026 14:101577507-101577529 CTGGGGGCCCAGAGCCCTGATGG + Intergenic
1124910465 15:33915511-33915533 CTGGGGACCAAGAGCCCACAGGG - Intronic
1125581540 15:40789258-40789280 CTGAGGAACCAGAGCCCAAAGGG - Intronic
1125721301 15:41846414-41846436 CTGGGGACTCAAGGCTCAGGTGG - Intronic
1126857074 15:52848859-52848881 CTGGGGTCTCACAGCACAGTAGG - Intergenic
1126993057 15:54406017-54406039 CTGAGGACTCAGAGGATAGAAGG - Intronic
1127281476 15:57497108-57497130 CTGGGGACTGATATCCCAGCTGG + Intronic
1128511715 15:68317506-68317528 CTGGGGTCTCAGACATCAGAAGG - Intronic
1128609522 15:69062830-69062852 CTGGGGAGACAAAGCCCACAAGG - Intergenic
1129389283 15:75212583-75212605 CTGGGGGAACAGAGCCCAGCAGG - Intergenic
1129470297 15:75750031-75750053 CTGGGCACCCCCAGCCCAGAGGG + Intergenic
1129779050 15:78257331-78257353 CTGAGGACTTGGAGCCAAGAAGG + Intergenic
1131017221 15:89067803-89067825 TTGGACTCTCAGAGCCCAGAAGG - Intergenic
1131248551 15:90816604-90816626 CTGGGGACTCAGTCCTGAGAGGG + Intergenic
1131265542 15:90913185-90913207 CTGGGGGATCAGAGCCGAGCTGG - Intronic
1132198052 15:99928648-99928670 CTGCGGCCTCTCAGCCCAGAAGG + Intergenic
1132323024 15:100940985-100941007 CTGGGGACTCTGAGGCCCAAGGG + Intronic
1132457470 16:32149-32171 CTGGGTCCTCAGATCACAGAGGG + Intergenic
1132682757 16:1150121-1150143 CAGGGGACACAGAGCCCCCAAGG + Intergenic
1133206146 16:4234994-4235016 CTGGTGACTCGCAGCACAGATGG - Intronic
1134056830 16:11175325-11175347 CTGGGGAGACAGAGCCGAGGGGG - Intronic
1134510723 16:14844861-14844883 CTGGGGACTTTGATCCCACAAGG + Intronic
1134698362 16:16243348-16243370 CTGGGGACTTTGATCCCACAAGG + Intronic
1134973472 16:18551330-18551352 CTGGGGACTTTGATCCCACAAGG - Intronic
1135425245 16:22329533-22329555 CTGGGGACAGAGAGCTCAGTGGG - Intronic
1137367152 16:47870518-47870540 GAGGGGTCTCAGAGCCAAGATGG + Intergenic
1137576992 16:49606562-49606584 CAGGGGGCTCAGGTCCCAGAGGG + Intronic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1139642328 16:68301217-68301239 CTCTGGACTCAGAGCCCTCAAGG + Exonic
1139952276 16:70678220-70678242 CTGGGGACTCAGACCCCAGAGGG - Intronic
1140389576 16:74573643-74573665 CTGGGGAAGCTGAGCCCAGGAGG - Intronic
1141609853 16:85175206-85175228 CTGGGGACCCGGGGCCCAGCTGG - Intronic
1141659031 16:85431725-85431747 CTGAGCACCCAGGGCCCAGAGGG + Intergenic
1141853147 16:86661467-86661489 CTGGGGACTGACAGTCCAGCTGG - Intergenic
1142023438 16:87799064-87799086 CTTGGGAATGAGACCCCAGAGGG + Intergenic
1142038940 16:87880461-87880483 CTGGGGGCTCACATTCCAGAGGG + Intergenic
1142119767 16:88381506-88381528 CTGTGGACAAAGACCCCAGAGGG - Intergenic
1142847625 17:2689920-2689942 CTGGGCCCTCAGAGCCCAGTGGG - Exonic
1143104088 17:4519799-4519821 ATGGGGACACAGAGGCCAGCAGG - Intronic
1145189918 17:20830412-20830434 CTGAGGCCTCAGAGCCCTGAGGG + Intergenic
1145262785 17:21364765-21364787 CTGGGTGCTCAGGGCCCAAACGG - Intergenic
1145935949 17:28714943-28714965 CTGGGGACACAGGGCACAGCTGG + Intronic
1145976576 17:28987363-28987385 CTGGGGCCTCACAGTACAGAGGG - Intronic
1147170714 17:38617248-38617270 TCTGGGGCTCAGAGCCCAGATGG + Intergenic
1147760789 17:42796294-42796316 CTGGGGGCTCAGAGCGCTGTAGG - Exonic
1147892485 17:43727147-43727169 CTGGGGACTCAGAATCAAGGAGG - Intergenic
1147950552 17:44105311-44105333 CTCGGGATGCAGAGCCCTGATGG + Intronic
1148745190 17:49914136-49914158 CTAAGGACTTAGAGCCCAGAGGG + Intergenic
1148872627 17:50667787-50667809 CTGGGCACCCAGAGCCCTGGAGG - Intronic
1150076756 17:62198745-62198767 CTGAGGCCTCAGAGCCCTAAGGG - Intergenic
1150248748 17:63694555-63694577 AGGGGTACTCAGAGCCCAGAGGG - Exonic
1150533128 17:66006770-66006792 CTGAGGATGCAGAGCCCAGGTGG + Intronic
1151214606 17:72569114-72569136 AGGGGGACTCAGAGCCGAGGAGG - Intergenic
1151589016 17:75031186-75031208 CAAGGGACTCAGAGCCTAGGAGG + Intergenic
1151811820 17:76448166-76448188 CTCGGGCCTCAGTGCCCTGATGG - Intronic
1151846238 17:76657887-76657909 GTGGGTACAAAGAGCCCAGATGG - Intergenic
1152105447 17:78326048-78326070 CTGGGGACACAGGGCCCTGTGGG - Intergenic
1152458253 17:80428174-80428196 CTGGGGGCTCTGAGCCCAGCTGG - Intronic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1153945810 18:10016242-10016264 CTGGGGAGGCAGAGCAGAGATGG + Intergenic
1156309023 18:35905763-35905785 CTGTAGACTTTGAGCCCAGATGG + Intergenic
1156346697 18:36263520-36263542 CTGGGATCTCAGAGCCCACTTGG - Intronic
1157248067 18:46071376-46071398 CTGGGGAGTGAGAGGACAGAGGG + Intronic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1157684382 18:49630842-49630864 CTGAGGACTCTGAGTCCTGAGGG - Intergenic
1157879392 18:51305366-51305388 CTGGAGACTCAGGGGCCAGGGGG + Intergenic
1160078853 18:75703982-75704004 CTGGGGATTCAGAGCCCTGGGGG + Intergenic
1160078901 18:75704174-75704196 CTGGGGACACAGAGACCTGGGGG + Intergenic
1160715978 19:576991-577013 CTGGGGAGTCTGACCTCAGAAGG + Intronic
1160755964 19:757329-757351 CTGGGGACGCTGACCCCAGGAGG + Exonic
1160804380 19:985552-985574 CTGGGGCCCAAGAGCCCAGTAGG - Intronic
1161161461 19:2763789-2763811 CTGGCGGCTCTGAGCCCAGCGGG + Intronic
1162805726 19:13137154-13137176 CTTGGGACCCAGAGCCCAGCAGG + Intronic
1163190276 19:15672473-15672495 CTGGGGATAAAGAGCCCAGCTGG - Intergenic
1163202904 19:15780962-15780984 CTGGGGATAAAGAGCCCAGCTGG + Intergenic
1163826543 19:19527652-19527674 GTGGGGCCTCAGTGCCCTGAGGG - Intronic
1164566530 19:29329741-29329763 CTGGGGAAACAGAGCCAAGCTGG + Intergenic
1165427988 19:35756192-35756214 CTGGGGAATCAGTGCCCTGGGGG - Intronic
1165899354 19:39161629-39161651 CAGGGGTCTCTGAGCCCAGGAGG - Intronic
1165950822 19:39473180-39473202 CTGGGGACGCAGAGAACAAATGG - Intronic
1166368738 19:42290292-42290314 CTGGGGGCTCAGGGTCCAGTGGG - Exonic
1166963791 19:46515524-46515546 CTTGGGACTCAAAGTCCAGTGGG - Intronic
1166981209 19:46633365-46633387 CTTGGGGCTCAGAGTCCAGTAGG - Intergenic
1167673623 19:50870988-50871010 CTGTGTGGTCAGAGCCCAGAGGG + Intronic
1168242666 19:55095279-55095301 CTGGGGACTCACAGGACAGAGGG + Exonic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925921795 2:8643527-8643549 CCGGGCACCCAGAGCCCATATGG - Intergenic
926435145 2:12829544-12829566 TTGGGGACACAGATCCAAGAAGG - Intergenic
926533146 2:14077487-14077509 CTGGGGTCTGAGAGTCCAAAAGG - Intergenic
926736739 2:16079174-16079196 CTGGGAACTCAGAGTCGAGCAGG + Intergenic
926771998 2:16386608-16386630 TTGGGGAGTGAGAGCCCGGAAGG + Intergenic
926907061 2:17815976-17815998 TTAGGGAATCAAAGCCCAGAGGG + Intergenic
927635563 2:24813548-24813570 CTGGGGACTGAGAAACCAAACGG - Intronic
927696350 2:25242167-25242189 CTGGGGACTCATAGCGGAGGGGG - Intronic
927932689 2:27055329-27055351 CTGGGAACACAGAAGCCAGAAGG - Intronic
928089726 2:28366723-28366745 CAGGAGCCTCACAGCCCAGAGGG - Intergenic
928188869 2:29143087-29143109 CTGAGGTCACAGAGCCAAGAGGG + Intronic
928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG + Intergenic
929440774 2:41964472-41964494 CTGGGGTCCAAGATCCCAGAGGG + Intergenic
929758965 2:44790594-44790616 CTGGGAAGCCAGAGCCCAAAAGG + Intergenic
930115906 2:47718065-47718087 AAGGAAACTCAGAGCCCAGACGG + Intronic
931179225 2:59883122-59883144 GTGGGGTCTCAGAGCTGAGAGGG - Intergenic
931208656 2:60171715-60171737 CAGGGGCAGCAGAGCCCAGAGGG + Intergenic
931664668 2:64601661-64601683 CTGGTGACACAGAGCCCATGTGG - Intergenic
931767344 2:65468485-65468507 CTGGGGCATCAGATCACAGAGGG + Intergenic
932714434 2:74091026-74091048 CTTGGCAGTCAGAGCACAGAAGG - Intronic
932842072 2:75092693-75092715 CTGGAGACTCAGAGCCCCACTGG + Intronic
934866471 2:97817829-97817851 ATGTGGACTCTGAGCACAGATGG + Intronic
937093730 2:119223181-119223203 GTAGGGTTTCAGAGCCCAGAAGG + Intergenic
937244265 2:120482468-120482490 CTGGTGACTCAGATACCAGGCGG - Intergenic
937250023 2:120517716-120517738 GTGGGGACTCAGAGCAGAGAGGG - Intergenic
937855633 2:126670463-126670485 CTGGGGAAGCAGAGGCCAAAGGG - Intronic
937889872 2:126930751-126930773 CTGGGGACTGGGATGCCAGACGG + Intergenic
939322628 2:140644079-140644101 CTGGGGAATCAGCACGCAGAGGG - Intronic
940883261 2:158968351-158968373 CGGGGGACCCGGTGCCCAGAGGG + Intergenic
942605859 2:177689976-177689998 TCAGGGACTCAGAGCCCAGTGGG - Intronic
944137441 2:196414662-196414684 CAGGGGCCTCAGAGGCCAGATGG - Intronic
944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG + Exonic
944743474 2:202634648-202634670 CTGGGGACTCAGACTCTGGAAGG - Intergenic
947475794 2:230446706-230446728 TGGGTGACTCAGAGCTCAGAGGG - Intronic
947635952 2:231680925-231680947 CCGGGGACTCCGAGCGCAGCTGG + Intergenic
947955767 2:234189486-234189508 CAAGGGACTCCTAGCCCAGAGGG + Intergenic
948786925 2:240357485-240357507 CTGGGGACACCGAGCGGAGAAGG + Intergenic
948987854 2:241536329-241536351 TTCGTGACTCAGATCCCAGAGGG + Intergenic
1168850497 20:973345-973367 CTGGGGACACTGAGGCCAGAAGG + Intronic
1168860648 20:1043955-1043977 CAGGGGACTCAGTGCCGAGTTGG - Intergenic
1169263012 20:4151225-4151247 CAGTGGAGTCAGAGCACAGAGGG - Intronic
1170708660 20:18768849-18768871 AAGGGGACTCAAAGCCCAGTAGG - Intergenic
1172185408 20:33028290-33028312 CTGGGGCCACTGAGGCCAGAGGG - Intergenic
1172444688 20:34986863-34986885 CTGGGGACACAGGGCAGAGAAGG - Intronic
1173622155 20:44444995-44445017 CTGAGGACACAGAGGCCACAGGG + Intergenic
1173955479 20:47029134-47029156 CAGGGGACTCTGAGCTCAGAAGG + Intronic
1174068493 20:47883220-47883242 AAGGGGACTCAGGACCCAGAAGG + Intergenic
1175187795 20:57190539-57190561 CTGGGGTCTCCCAGCCCAGTGGG + Intronic
1175348454 20:58300589-58300611 TTTGGGACTCACAGCCCAGCAGG - Intergenic
1175945776 20:62558067-62558089 CTGGGGACTCTGAGCACTAAAGG - Intronic
1175969627 20:62677900-62677922 GTGGGGACAGAGAGCCCAGCTGG - Intronic
1175997224 20:62817254-62817276 CTGGCGACTCCGCGCCCCGACGG - Intronic
1176707439 21:10126444-10126466 GAGGGCACTCAGACCCCAGATGG - Intergenic
1179587050 21:42380065-42380087 CCAGGGGCTCAGAACCCAGAGGG - Intronic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
1181325577 22:22043286-22043308 CTGGGTACTCACAGGTCAGAAGG - Intergenic
1181344305 22:22206956-22206978 CTGTGGGTTCAGAGCCCAAAGGG - Intergenic
1181672087 22:24430450-24430472 ATGGGGACCCACAGCACAGAAGG + Intronic
1181759894 22:25051077-25051099 CAGGGGCCTCAGAGGCCAGAAGG - Intronic
1182081088 22:27529301-27529323 ATGAGGCCTCAGAGACCAGAGGG + Intergenic
1182947991 22:34343097-34343119 CTTGGGACTCAGATCAGAGAAGG + Intergenic
1183351940 22:37339326-37339348 CTGGGGACTCATAGCACCGTGGG + Intergenic
1183403987 22:37620936-37620958 ATGGGGACTCTGAGCCCAGGTGG + Intronic
1183726340 22:39592003-39592025 CTGGGGTCTCAGAGCTGAGCAGG - Intronic
1184041969 22:41949663-41949685 CTGGGGACCCTGGTCCCAGAGGG + Intergenic
1184054507 22:42035371-42035393 CTGTGCTCTCAGGGCCCAGAGGG - Intronic
1184119325 22:42440114-42440136 CTGGTGGCCCAGTGCCCAGAAGG - Intergenic
1184219333 22:43089277-43089299 CTGTGGGCTCAGAGCGCCGAGGG + Exonic
1184292806 22:43507128-43507150 CTGGGGGCTCACAGCACAAAAGG + Exonic
1184449589 22:44575106-44575128 CTTGGGACTCAGTGCCGAGTTGG - Intergenic
1184491752 22:44813984-44814006 CTGGGGAGACACAGCCCAGGAGG - Intronic
1185024514 22:48400635-48400657 CTGGGAAGACAGAGCCCAGCCGG - Intergenic
1185099141 22:48828294-48828316 CTGGGGACTCGGCTCCAAGAGGG + Intronic
1185287447 22:50008850-50008872 CTGGGGCCTGAGGGTCCAGAGGG - Intronic
950459973 3:13115386-13115408 ATGGGGGCCCAGACCCCAGAGGG - Intergenic
950577047 3:13838218-13838240 GTGGAGACCCAGGGCCCAGAGGG + Intronic
951691110 3:25397194-25397216 CTGGGGACTGTGTGCCCACAGGG + Intronic
951865673 3:27304678-27304700 CTGGGGACTCTGTGACAAGATGG - Intronic
952834882 3:37594132-37594154 CTGCTGACCCAGAGCTCAGATGG - Intronic
953885245 3:46711365-46711387 CTGAGGACTCTGACACCAGATGG + Intergenic
954872128 3:53775467-53775489 CTGGGGAGGCTGAGCCCAGGAGG + Intronic
955046931 3:55369558-55369580 CTTGGCACTCAGTGGCCAGAGGG + Intergenic
955879310 3:63526874-63526896 CTGTGTGCTCAGAGCTCAGATGG + Intronic
956190912 3:66607487-66607509 CTTGGGACTCACAGTCTAGATGG - Intergenic
956503853 3:69916375-69916397 TTGGGGCTTCAGAACCCAGAAGG + Intronic
957290011 3:78268018-78268040 CTGGGGACTAAGATGCCAGATGG + Intergenic
959724821 3:109531438-109531460 CTATTGACTCAGAGCACAGAAGG + Intergenic
960610317 3:119549486-119549508 CAGGGGATACAGGGCCCAGAAGG - Intronic
960936595 3:122907954-122907976 CTGGGGTCTCAGAGCCCCCTTGG - Intergenic
960987540 3:123290533-123290555 CTGGGGATGCAGAGCCCGGTAGG - Intronic
961047276 3:123718206-123718228 CTGGGGGCTCAGTGCCCATTAGG - Intronic
961107867 3:124257672-124257694 CAGGGGACCCATGGCCCAGATGG + Intronic
961270684 3:125685426-125685448 CTGGGGGCTCAGTGCCCATTAGG + Intergenic
961441282 3:126954759-126954781 CTGGGGTCTCAGACTCTAGAGGG + Intronic
961467254 3:127089379-127089401 CTGGGGACCCAGGTTCCAGAGGG - Intergenic
961666164 3:128494111-128494133 CTGGGGACCTTGAGCCCAGAGGG + Intergenic
961809674 3:129514660-129514682 CAGGGGGCACAGAGCCTAGAGGG - Intronic
964869127 3:161293634-161293656 CTGAGAACTCAGACCCCAGGTGG - Intergenic
966200046 3:177352696-177352718 CTGGTGGCTCAGAGCCCATGTGG - Intergenic
968442301 4:630077-630099 CAGGGGACACAGAACCCAGAGGG + Intronic
969978028 4:11124506-11124528 CTGGGGAGTCAGTGCAAAGAAGG + Intergenic
971046494 4:22810917-22810939 TTTGGGACTCAGAGCCCAGTTGG + Intergenic
972775046 4:42232608-42232630 ATGGGGCCACTGAGCCCAGAAGG + Intergenic
973040141 4:45459769-45459791 CTGGGAGTTCAGAGCACAGAGGG + Intergenic
975509703 4:75180868-75180890 TTGGGGACCGAGAGCCCACAGGG - Intergenic
976796723 4:88941979-88942001 CTTGGGTCTTAGAGCCAAGATGG - Intronic
978580674 4:110228541-110228563 ATGGGGAAGCAGATCCCAGATGG + Intergenic
980808033 4:137838278-137838300 CTGGGGACTAAGAAGCCAGATGG - Intergenic
981064689 4:140470147-140470169 CAGAGGACTGAGAGCACAGAAGG - Intronic
981943372 4:150311540-150311562 CTGGGGACACAGAGGACTGATGG + Intronic
981985256 4:150846551-150846573 ATGGAGACTCAGAACTCAGAAGG + Intronic
985745586 5:1645063-1645085 CTGGGGACGCGGAGACCACACGG - Intergenic
987072892 5:14354440-14354462 CTGGTTTCTCAGTGCCCAGAAGG + Intronic
990156921 5:52888121-52888143 CTGGGTACTAAGGACCCAGAGGG - Intronic
990456736 5:55995407-55995429 CGAGGGACTCAGAGCCGCGAGGG + Intergenic
992202890 5:74401509-74401531 CTGGAGAGCCAAAGCCCAGAAGG - Intergenic
992204870 5:74421500-74421522 CAGGGGACCCAGACCCCAGTGGG - Intergenic
993057303 5:82996859-82996881 ATGGGAACTCAGAGCTCAGCAGG - Intergenic
993558691 5:89375832-89375854 TTGGGGACTCAGAAGCCAAATGG - Intergenic
994182365 5:96781798-96781820 GTGGGGGCCCAGAGCACAGAAGG - Exonic
997389989 5:133506749-133506771 CTGAGCACTGAGAGCCAAGATGG - Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
1000352021 5:160359713-160359735 GTGGGGACCCAGGGCCCAGGAGG - Intronic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1001579715 5:172790293-172790315 GAGGCGACTCAGAACCCAGAGGG + Intergenic
1001686851 5:173599759-173599781 ATGGGGTGTCAGAGCCCAAACGG + Intergenic
1001701492 5:173709932-173709954 GCGGGGACTCTGAGCTCAGATGG - Intergenic
1001772501 5:174306788-174306810 CTGGGGACTGAGACATCAGAGGG - Intergenic
1001798055 5:174518687-174518709 GTGGGGAAGCAGAGCCCACATGG - Intergenic
1002196229 5:177503095-177503117 CTGGGCAGTCAGAGCCCTGGAGG + Intronic
1002299434 5:178248988-178249010 CTGCGGTCTCAGTGCCCAGCCGG - Intronic
1002464964 5:179403641-179403663 GAGGGAACTCAGAGTCCAGATGG + Intergenic
1002799278 6:505638-505660 CCGGGGACACAGTGCCCAGGAGG - Intronic
1003149772 6:3538646-3538668 CCATGGACACAGAGCCCAGATGG + Intergenic
1003277651 6:4666126-4666148 CTGGGGACTCAGACCCCATCGGG + Intergenic
1005530580 6:26701277-26701299 CTGGTAACGCAGAACCCAGACGG + Intergenic
1005540216 6:26800369-26800391 CTGGTAACGCAGAACCCAGACGG - Intergenic
1006385166 6:33726746-33726768 CTGGGTACTCGGAGCACAGGCGG + Exonic
1006392441 6:33766449-33766471 CTGGGTACGCAGACCCCAGGTGG - Intergenic
1007162164 6:39800572-39800594 CTGGGGACTCAGTCCTCAAAGGG - Intronic
1007349244 6:41256549-41256571 CTGGGGACTGAAATGCCAGATGG - Intergenic
1007419502 6:41711344-41711366 GTGGGGACGTTGAGCCCAGAGGG - Intronic
1007461988 6:42025706-42025728 CTTGTGACTCAGAGCCCAAAAGG - Intronic
1007612751 6:43160964-43160986 CAGGGGCCTCAGGGCCCAGGAGG - Exonic
1008379201 6:50823448-50823470 CTTGGGACACCGAGCCCAGCTGG - Exonic
1008610039 6:53177275-53177297 CTAGGGACTAAGTTCCCAGAGGG - Intergenic
1009011030 6:57842470-57842492 CTGGTAACGCAGAACCCAGACGG - Intergenic
1011880786 6:92023101-92023123 CTGGGGACTTAGAGTCTAAAAGG - Intergenic
1013368498 6:109451883-109451905 CTGAGGACTTAGAGCAAAGAGGG + Intronic
1013967434 6:115971876-115971898 CTGGATGCTCAGAGCCCAGCTGG - Intronic
1015842008 6:137487293-137487315 CTGTGCCCTCAGAGCCTAGAGGG - Intergenic
1018908293 6:168087838-168087860 CGGGGGTCTCCGTGCCCAGACGG - Intergenic
1019227336 6:170524105-170524127 ATGGGGGCTCAGATCCCTGATGG - Intergenic
1019567047 7:1689355-1689377 CTGAGGGCTCAGAGCTCAGATGG + Intronic
1019609797 7:1930650-1930672 CTGGGGAATCAGGGCCCCCAAGG - Intronic
1019700254 7:2471417-2471439 CTGGGGTCTCTGAGCCCGGCAGG - Intergenic
1020244354 7:6419404-6419426 CTGGGCAGGCAGAGCCCAGCAGG + Intronic
1022237573 7:28476969-28476991 CTGGAGAATCATTGCCCAGAGGG + Intronic
1022835877 7:34114205-34114227 CTGGGGACTCGGCCCCCACAGGG - Intronic
1023839389 7:44087946-44087968 CTCCGGACTCAGAGCCAGGAGGG - Intergenic
1023878364 7:44305201-44305223 CTGTGGCCTGAGAGCCCTGAAGG - Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1027054404 7:75040079-75040101 CTGGGCAGACAGAGCCCAGCTGG + Intronic
1028570762 7:92284264-92284286 CTGGGGAGTCAGGGCACATAAGG + Intronic
1029598654 7:101551005-101551027 CTGCAGACTCAGAGCACAGTGGG + Intronic
1030690063 7:112523216-112523238 CTCGGTTCTCAGAGCCCACAGGG + Intergenic
1031082747 7:117274452-117274474 CTGGGGTCCCTGAGCCCAGTGGG + Intergenic
1034431918 7:151045417-151045439 CTGGGGGCTCAGTCCCCAGTAGG - Exonic
1034431920 7:151045421-151045443 CTGGGGACTGAGCCCCCAGGAGG + Exonic
1035228369 7:157445841-157445863 CTGGGGACTCAGGCCTCAGCAGG - Intergenic
1035371987 7:158385938-158385960 ATAGGGACTCAGAGCACAGGAGG - Intronic
1035372077 7:158386209-158386231 ATAGGGACTCAGAGCACAGGAGG - Intronic
1036660704 8:10706643-10706665 GTGGGAACTCACTGCCCAGAAGG + Intronic
1036660824 8:10707362-10707384 GTGGGAACTCAGTGTCCAGAAGG - Intronic
1037926346 8:22846685-22846707 CTGGAGACTCCGGGCCCAGTGGG - Intronic
1042863022 8:73332826-73332848 CTGGGGACTGAAAACCCAAAGGG + Intergenic
1047367742 8:124227911-124227933 CCAGGGACTCACAGCCCAGTGGG + Intergenic
1047412722 8:124637426-124637448 GTGGGGGCTGAGACCCCAGAAGG + Intronic
1048364345 8:133725303-133725325 CTGGGGGATGAGAGGCCAGATGG + Intergenic
1048458650 8:134601703-134601725 CTGGTGACCCAGATCCCAGCAGG - Exonic
1048503806 8:135002691-135002713 CTGGAGAATGAGAGCCCACATGG + Intergenic
1048842522 8:138578190-138578212 CAGGGCATTCAGAGACCAGATGG + Intergenic
1048971404 8:139647016-139647038 CTGGGAGCCCAGTGCCCAGATGG - Intronic
1048983354 8:139715271-139715293 CTGGGGACTCCAAACCCAGCCGG + Intergenic
1049084052 8:140464227-140464249 CTGGGGATTCAGAGCCGAGTCGG - Intergenic
1049112690 8:140657954-140657976 CTAGGGACTCAGACTCCAAAGGG - Intronic
1049576628 8:143392732-143392754 TTGGGGAGCCACAGCCCAGAAGG + Intergenic
1049782588 8:144435685-144435707 CCAGGGTCTCAGAGCCCAGTGGG - Exonic
1050073605 9:1841292-1841314 CTGGGCAGACAGAGCCCAGCTGG + Intergenic
1051161334 9:14211704-14211726 CTGGGGAAGCACAGCTCAGACGG - Intronic
1051687764 9:19676019-19676041 CTGGGGACCAAGAGCCCATAGGG + Intronic
1052406435 9:28066740-28066762 TTGGGCATTCAGAGACCAGAAGG - Intronic
1053086267 9:35225721-35225743 CTGGGGACTGATATGCCAGATGG + Intronic
1053286978 9:36855950-36855972 CTGGGGACTCAGGGACCAGTGGG - Intronic
1053352406 9:37422481-37422503 CTGGGGAATCAGGGCCCCGGGGG - Intergenic
1053414395 9:37937937-37937959 TTGGGGAGTCAGAGCCCAAAGGG - Intronic
1053644633 9:40113182-40113204 GAGGGCACTCAGACCCCAGATGG - Intergenic
1053667058 9:40323916-40323938 CTTGGGATCCAGAGCCCTGATGG - Intronic
1053761349 9:41351669-41351691 GAGGGCACTCAGACCCCAGATGG + Intergenic
1053916649 9:42949025-42949047 CTTGGGATCCAGAGCCCTGATGG - Intergenic
1054325656 9:63711062-63711084 GAGGGCACTCAGACCCCAGATGG - Intergenic
1054378205 9:64463944-64463966 CTTGGGATCCAGAGCCCTGATGG - Intergenic
1054517552 9:66052367-66052389 CTTGGGATCCAGAGCCCTGATGG + Intergenic
1054539943 9:66262787-66262809 GAGGGCACTCAGACCCCAGATGG + Intergenic
1055208540 9:73762339-73762361 CTTGGGACTGAGATCCCAGAAGG + Intergenic
1055563139 9:77542376-77542398 CTGGGGACTAAGATGCCAGATGG + Intronic
1055739005 9:79365101-79365123 CTTGGGATCCAGAGCACAGATGG - Intergenic
1055986536 9:82060226-82060248 GTTGGGACTCAGGCCCCAGATGG + Intergenic
1056132075 9:83597013-83597035 CAGGGGACTCAGAGACCTGGGGG + Intergenic
1056584806 9:87920906-87920928 GTTGGGACTCAGGCCCCAGATGG - Intergenic
1057160630 9:92885971-92885993 GTTGGGACTCAGGCCCCAGATGG - Intergenic
1057550427 9:96048005-96048027 CTGGGGACGCAGGGCCCGGTGGG + Intergenic
1057576445 9:96246464-96246486 CTGGGGACACAGAGTCCATCTGG - Intronic
1057779475 9:98037736-98037758 CTGGGGCCTCAAACTCCAGAGGG + Intergenic
1059475814 9:114546821-114546843 CTGGGGATTCTGGGCTCAGAAGG + Intergenic
1059740639 9:117146212-117146234 CTGGGGAGTCAGAGCTCAGCGGG - Intronic
1060147820 9:121267834-121267856 CTGGGGCCAAAGAGCTCAGATGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060892693 9:127198736-127198758 CTGAGGACCCAGACCCCAGCGGG + Intronic
1060945246 9:127566630-127566652 CTGGGAACTCAGAGCACTGTGGG + Intronic
1061045767 9:128164020-128164042 CTGGCGGCTCAGAGGCCAGGTGG + Intergenic
1061149009 9:128818524-128818546 CTTGGGCCTCGGAACCCAGAAGG - Exonic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1061816759 9:133201942-133201964 CTGGGGGCTCAGAACCCTGGCGG + Intergenic
1062089973 9:134670805-134670827 GTGGGGACTCAGCACACAGATGG - Intronic
1062101900 9:134732881-134732903 CTGGGGTCTCAGAGCCACTAAGG + Intronic
1062186975 9:135223469-135223491 CTGGGAACCCAGAGTCCAGCTGG + Intergenic
1062254630 9:135615143-135615165 CTGGGGCCTGAGAGCCCAGAGGG + Intergenic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1202792187 9_KI270719v1_random:95324-95346 GAGGGCACTCAGACCCCAGATGG - Intergenic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1187480244 X:19648541-19648563 CTGGGGACAGACTGCCCAGAAGG + Intronic
1187693779 X:21897967-21897989 ATCTGGCCTCAGAGCCCAGAGGG + Intergenic
1189066059 X:37810465-37810487 CAGGGGGCACAGAGCCCTGAAGG + Intronic
1190237320 X:48626403-48626425 CTGGAGACTGAGAGGCCACATGG - Intergenic
1193865429 X:86725494-86725516 CTGGGGACTGGGATGCCAGATGG + Intronic
1196152863 X:112393446-112393468 CTGGGGATAAAGATCCCAGAAGG - Intergenic
1197078213 X:122378431-122378453 CTGGGTATTCAGGGCCCAGGGGG + Intergenic
1197345064 X:125320427-125320449 CTGGGAAGTTAGAGCCCAGGAGG - Intergenic
1197866559 X:131025320-131025342 CTGGAAAGGCAGAGCCCAGAGGG + Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198810401 X:140530457-140530479 CTGTGAAGTCAGAACCCAGAGGG + Intergenic
1199940158 X:152618278-152618300 CTTGGGAGACACAGCCCAGAAGG + Intergenic
1200398886 X:156007231-156007253 CTGGGTCCTCAGATCACAGAGGG - Intronic
1200827434 Y:7659077-7659099 CTGGGGACTCAGAGGCCTGTGGG + Intergenic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic
1200986205 Y:9305097-9305119 CTGGGGGCTCAGAGGCCTGTGGG + Intergenic
1201150943 Y:11095272-11095294 CTGGGGACTCAATGTCCAAATGG - Intergenic
1202232417 Y:22670568-22670590 CTGGGGGCTCAGAGGCCTGTGGG - Intergenic
1202310739 Y:23525590-23525612 CTGGGGGCTCAGAGGCCTGTGGG + Intergenic
1202560063 Y:26145004-26145026 CTGGGGGCTCAGAGGCCTGTGGG - Intergenic