ID: 914471755

View in Genome Browser
Species Human (GRCh38)
Location 1:147985570-147985592
Sequence AGGTGAGCAAACTCTGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914471755_914471758 18 Left 914471755 1:147985570-147985592 CCAGTGGCAGAGTTTGCTCACCT 0: 2
1: 0
2: 0
3: 18
4: 167
Right 914471758 1:147985611-147985633 ATTTCATGTGATTATTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914471755 Original CRISPR AGGTGAGCAAACTCTGCCAC TGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901273968 1:7976187-7976209 AAGTGTACAAACTGTGCCACAGG + Intronic
903277275 1:22230221-22230243 AGGTGAGGAAACTGAGGCACAGG + Intergenic
904634534 1:31869682-31869704 TGATGAGCAGAGTCTGCCACAGG + Intergenic
910182879 1:84505355-84505377 ATATGAGCAAACTGTGCCATAGG + Intronic
911230342 1:95354356-95354378 AGGAGAGCAAACTTTGCAATTGG + Intergenic
911418548 1:97608584-97608606 AGGTGAGGAAACTAAGGCACAGG - Intronic
913677805 1:121158362-121158384 AGGAAAGCAAAATCTACCACAGG + Intergenic
914029639 1:143945991-143946013 AGGAAAGCAAAATCTACCACAGG + Intronic
914159810 1:145121959-145121981 AGGAAAGCAAAATCTACCACAGG - Intergenic
914219172 1:145662699-145662721 AGGTGAGCAAACTCTGCCACTGG - Intronic
914471755 1:147985570-147985592 AGGTGAGCAAACTCTGCCACTGG - Intronic
915454604 1:156031366-156031388 AGATGAACAAACTCAGGCACAGG + Intergenic
916191031 1:162178537-162178559 AGGTGAGGAGACTCAGGCACAGG + Intronic
916499483 1:165374683-165374705 AGGTGAGAAAACCCAGCTACTGG + Intergenic
916567314 1:165992281-165992303 AGATGAGGAAACTGAGCCACAGG - Intergenic
916584368 1:166137583-166137605 AGGTGAGGAAACTCAGTCACAGG - Intronic
919729749 1:200905772-200905794 AGGTTAGCAAACTATGGCCCAGG - Intronic
920596915 1:207281123-207281145 AGATGAGCAATCTCAGCAACAGG - Intergenic
921516151 1:216094858-216094880 AGGTGAGGAATCTGGGCCACAGG - Intronic
922711909 1:227840648-227840670 GGGTGAGCAAACTCTGTAAAGGG - Intronic
923715890 1:236424626-236424648 ATGAGAGCAACCACTGCCACAGG - Intronic
923881820 1:238111745-238111767 AGGGGAGTAAACCCTCCCACAGG - Intergenic
924233249 1:241979536-241979558 AGGTCAGCAAACTGTGGCCCAGG + Intergenic
1063684861 10:8227418-8227440 AGGTGAGCAAACTGAGCCATGGG + Intergenic
1065981079 10:30897860-30897882 AGGTGAACAATCTCTGTCAGCGG - Intronic
1066643584 10:37581563-37581585 AGGTGAGAAAACTGTGACACAGG + Intergenic
1068816659 10:61322977-61322999 AGATGAGCAAACTGAGGCACAGG - Intergenic
1068885611 10:62093584-62093606 AGGTGAGCAAACAGTGATACAGG - Exonic
1070406610 10:76103367-76103389 TGATGAGGAAACTCTCCCACTGG - Intronic
1071939900 10:90577815-90577837 AGATGAACAAACTATGGCACAGG + Intergenic
1073110813 10:101062114-101062136 AGGTGAGCACTCTGTGCCCCAGG + Exonic
1073237574 10:102031227-102031249 AGATGAGAAAACTGAGCCACTGG - Intronic
1074160137 10:110830075-110830097 AGGTGAGGAAACTGAGCCCCAGG + Intronic
1074555203 10:114483076-114483098 GTGTGTGGAAACTCTGCCACTGG + Intronic
1077982946 11:7319838-7319860 AGGTAAGTAAACTCTGCAGCTGG - Intronic
1080515626 11:33016671-33016693 AAGTTGGCAAATTCTGCCACGGG + Intronic
1080898878 11:36468436-36468458 AGCTGAGCAGATTCTGCCCCTGG - Intergenic
1082865968 11:57900495-57900517 TGGTGAGCAAACTCAGCTCCAGG + Intergenic
1083183895 11:61006641-61006663 AGGTGAGCAAACATTCCCTCTGG + Exonic
1083464143 11:62834082-62834104 AGGTGAGGAAACTAAGGCACAGG + Intronic
1091284479 11:134400364-134400386 AGGTGAGGAAACTGAGTCACAGG - Intronic
1091665891 12:2418332-2418354 AGGAGAGCAACCACTGCCATTGG + Intronic
1091679851 12:2519370-2519392 AGGTGAGCTCACACTGCCCCTGG + Intronic
1091850879 12:3695917-3695939 GAGTGGGCAAACTCTGCCCCTGG + Intronic
1095443388 12:42260380-42260402 AGGTGAGGAAACTGAGGCACAGG - Intronic
1100354110 12:93812758-93812780 AGGAAAGCAAACTCTGGCTCAGG + Intronic
1102878241 12:116464650-116464672 AGGTGAGGAAACTGAGGCACAGG + Intergenic
1102969463 12:117154952-117154974 AGGTGAGGAAACTGAGGCACAGG - Intronic
1105766881 13:23568481-23568503 TGGTGAATAAACTCTTCCACTGG + Intergenic
1109857307 13:68148148-68148170 AGGTGAGAAAACTGTGGCACAGG - Intergenic
1113786600 13:113005206-113005228 TGCTGAGCAAAATCAGCCACAGG + Intronic
1113804894 13:113106909-113106931 AGGTGAGCAGGGACTGCCACTGG + Exonic
1118540832 14:66822844-66822866 AGGTGAGAAAACTGTGGCACAGG + Intronic
1119174880 14:72561747-72561769 GGGTCATCAAACTCTGCCTCTGG + Intronic
1119644849 14:76340795-76340817 AGGTTGGCAAACTCTGTCATGGG + Intronic
1120333107 14:83118733-83118755 ATGCTAGCAAACTCTACCACAGG + Intergenic
1120609992 14:86627761-86627783 AGATTAGCAAACTCTGCCGATGG + Intergenic
1122099769 14:99398408-99398430 AGGTCTGCAAAATCTCCCACAGG + Exonic
1122293312 14:100691191-100691213 AGGTGAGGAAACTGAGGCACAGG - Intergenic
1124379178 15:29150148-29150170 AGGTGAGGAAACTGAGGCACAGG + Intronic
1128072456 15:64806390-64806412 AGATGAGCAAACTGTGGCTCAGG - Intergenic
1130876455 15:88018682-88018704 AGGTGAGGAAACTGAGGCACAGG - Intronic
1131953439 15:97706038-97706060 AGGTGAGCAAACTTTGTCAGTGG + Intergenic
1132702010 16:1225986-1226008 ATGTGGGGAAACTCAGCCACGGG + Intergenic
1135498227 16:22971192-22971214 AGGTGAGGAAACTAAGACACAGG + Intergenic
1136710650 16:32234164-32234186 AGCTCAGCAAACTGTGGCACAGG - Intergenic
1136757261 16:32695247-32695269 AGCTCAGCAAACTGTGGCACAGG + Intergenic
1136810847 16:33175128-33175150 AGCTCAGCAAACTGTGGCACAGG - Intergenic
1136817323 16:33285208-33285230 AGCTCAGCAAACTGTGGCACAGG - Intronic
1136823886 16:33341737-33341759 AGCTCAGCAAACTGTGGCACAGG - Intergenic
1138217805 16:55220109-55220131 AGATGAGTAAACTGTGGCACAGG - Intergenic
1140131921 16:72170297-72170319 AGGTGAGCAGATTCTGAAACAGG - Intronic
1141077599 16:81021705-81021727 AGGTGAGTACACCTTGCCACAGG + Intronic
1203059411 16_KI270728v1_random:955598-955620 AGCTCAGCAAACTGTGGCACAGG + Intergenic
1145267538 17:21387573-21387595 AGGTGAGGAAACTGAGACACAGG - Intronic
1147121110 17:38335562-38335584 ATGAGAGCAAAGTCTGCCCCAGG + Intronic
1155578635 18:27277812-27277834 AGCTGAGCTAAATCTGACACTGG + Intergenic
1157413246 18:47481493-47481515 AGCTAAGCACAATCTGCCACGGG - Intergenic
1157576998 18:48750230-48750252 AGGTGGGCATACTGAGCCACGGG + Intronic
1159947453 18:74454940-74454962 GGGGGAGCAGACTTTGCCACAGG - Intronic
1160488449 18:79315800-79315822 AGTTAAGTAATCTCTGCCACAGG - Intronic
1160965968 19:1747113-1747135 AGGTGAGGAAACTGAGGCACAGG - Intergenic
1161738683 19:6007207-6007229 AGGTGGGCTCACTCAGCCACGGG + Intronic
1161827420 19:6577725-6577747 AGGAGAGAAGAATCTGCCACAGG + Intergenic
1162956642 19:14102508-14102530 AGGAGCACAAACTCTGCCCCAGG - Intronic
1164487683 19:28674412-28674434 GGGTCAGCAAACTCTGGCACAGG + Intergenic
1167694097 19:51003776-51003798 TGGAGAACAAACTCTGTCACTGG - Exonic
925142498 2:1559636-1559658 AGGTGAGGAAACTGAGGCACGGG + Intergenic
925149027 2:1601928-1601950 AGGTGAGCACATTCTGCAGCTGG + Intergenic
925781616 2:7387149-7387171 AGATGAGAAAACTGTGCCTCAGG + Intergenic
926784468 2:16506936-16506958 AGATGAGCAAACTGAGGCACTGG + Intergenic
927368358 2:22325828-22325850 AGGTGAGCTCACTCAGCCTCAGG + Intergenic
928871558 2:35987117-35987139 AGTTGTGCAAACTCTGGCGCCGG + Intergenic
928946852 2:36779274-36779296 AGGTGAGGAAACTCATGCACAGG - Intronic
930837104 2:55805998-55806020 AGGTGAGCACTCTCTGCCAATGG - Intergenic
932910691 2:75803154-75803176 AGATTAGCAATGTCTGCCACAGG - Intergenic
935192608 2:100791049-100791071 AGGGGAGGAAATTCTGCCACAGG - Intergenic
935816431 2:106850284-106850306 GAGAGAGCAAACTCTGCCACAGG - Intronic
937276263 2:120686010-120686032 AGGTGAGGAAACTGAGCCAAGGG + Intergenic
939121760 2:138125665-138125687 AGCTGAGCAAATTCTGTCCCTGG - Intergenic
941198014 2:162474168-162474190 AGGTTAGCAAACTTTCCCAGGGG + Intronic
944401900 2:199336887-199336909 AGGTGAGGAGACTGTGCCATAGG - Intronic
944663411 2:201939717-201939739 AGGGGAGCAAACCCTTCCATCGG + Intergenic
946118767 2:217490257-217490279 AGGTGAGGAAACTGAGGCACAGG + Intronic
946638353 2:221755523-221755545 AGGTGAGAAAACTGAGGCACAGG + Intergenic
947667247 2:231914105-231914127 AGGTGAGCAAGCTGTGGCAGTGG - Intergenic
948762260 2:240199422-240199444 AAGTGACCCAACTCTCCCACAGG - Intergenic
948861091 2:240752864-240752886 AGGTGAGGACACTCAGGCACGGG + Intronic
1168924847 20:1571049-1571071 AGGTGAGCAATTTCTACCCCCGG - Exonic
1169996151 20:11558797-11558819 ATGTGGGCAAGCTCTGCCGCTGG + Intergenic
1173627392 20:44483261-44483283 AGGGGCCCAAACTCTGGCACTGG + Intronic
1173650902 20:44663457-44663479 AGGTGAGAGATCTCTGCCTCAGG + Intergenic
1175729666 20:61345807-61345829 AGGTGGACAACCCCTGCCACTGG + Intronic
1176255609 20:64151154-64151176 AGGTGAGCCGTCTCTTCCACTGG - Intergenic
1178690130 21:34743640-34743662 AGGTGAGAAAACTGAGGCACAGG - Intergenic
1179779312 21:43689261-43689283 AGGTGCGCAAACTCTGTGAAGGG - Intronic
1181757807 22:25037500-25037522 GGGTTAGCAAACTGTGCCCCTGG + Intronic
1183582831 22:38735854-38735876 AGGTGAGCTGCCTCTGCCCCTGG - Exonic
1184369016 22:44070818-44070840 AGGTGAGCAAAGTCCCGCACAGG - Intronic
949605942 3:5653676-5653698 AGGTGAGCAAACTCATGAACTGG - Intergenic
950744641 3:15077410-15077432 AGGTGAGCAACCTATGCAACTGG + Intronic
952114086 3:30158607-30158629 AGCTGAGCAAGTTCTGCCAATGG + Intergenic
952626936 3:35417029-35417051 AGGTAAGCAAACTATGAAACTGG - Intergenic
954808545 3:53234122-53234144 AGGCGAGGAAACTGAGCCACAGG - Intronic
960952967 3:123011549-123011571 AGGACAGCAGACTCTGCCCCTGG + Intronic
960987253 3:123288983-123289005 TGGTGAGCAAAATCTTCCAGTGG - Intronic
962240446 3:133747046-133747068 ATGTGTGCAACATCTGCCACTGG - Intronic
963337404 3:143991925-143991947 AAGTGAGAAAACACTGCCAGCGG + Exonic
964717936 3:159742268-159742290 GGCTGAGCAAATGCTGCCACTGG + Intronic
967932356 3:194699482-194699504 AGGTGTGCAGACTCTGCAACAGG + Intergenic
969172023 4:5371820-5371842 AGGTCAGCAAACTCTGTCCTGGG - Intronic
969217482 4:5733889-5733911 AGGTGAGAAAACTGAGGCACAGG + Intronic
972703553 4:41517362-41517384 TGGTAAGCAGTCTCTGCCACAGG + Intronic
972796677 4:42428229-42428251 AGGTGAGAAATCTAAGCCACAGG - Intronic
980521686 4:133944689-133944711 AGAAGAGAAAACTCTGCCATGGG - Intergenic
981009157 4:139906833-139906855 AGGTGAAAAAACTCTGTCCCAGG - Intronic
982200402 4:152954749-152954771 ATGTGAGAAAACTCTGGCTCTGG - Intronic
983373297 4:166892903-166892925 GGGTCAGCAAACACTGCGACAGG + Intronic
985678902 5:1245938-1245960 AGCTGAGCAAGCGCGGCCACCGG - Exonic
990827789 5:59921890-59921912 AGGTGAGCAATCTCTGTACCTGG + Intronic
991397888 5:66223551-66223573 AAGTGAGCCTTCTCTGCCACAGG - Intergenic
996263646 5:121507442-121507464 AGTGGTGTAAACTCTGCCACTGG + Intergenic
999501631 5:152152304-152152326 AGGTGAGCAAACTTAGCCATGGG - Intergenic
1001699407 5:173695956-173695978 AGCTGAGCACACTCTGCCCTGGG - Intergenic
1004460562 6:15831948-15831970 AAGTGAGCTGACTCTGCCCCAGG + Intergenic
1006030638 6:31174399-31174421 AGGTGAGGAAACTGAGGCACAGG - Intronic
1006249288 6:32766955-32766977 AGGTGAGTGATCTCTGGCACAGG + Intergenic
1006567595 6:34973726-34973748 AGCTGAACAAAATCTCCCACAGG - Intronic
1006603309 6:35239873-35239895 GGGTGAGCAGACTCAGCCAAAGG + Exonic
1007503840 6:42319089-42319111 AGGTGGAGAAACACTGCCACAGG - Intronic
1016094216 6:140016143-140016165 AGATGAGCAAATTGAGCCACAGG + Intergenic
1016592424 6:145761454-145761476 AGGTTATCAAACTCTGCCCATGG + Intergenic
1020782189 7:12531651-12531673 AGATGAGAAAACTAAGCCACAGG - Intergenic
1022729870 7:33012267-33012289 AGATGAGCAAACTGGGACACAGG + Intergenic
1024062709 7:45710697-45710719 AGGTGAGGAAACTGAGGCACAGG + Intronic
1029318914 7:99739883-99739905 AGATGAGCAAACTAAGCCACAGG + Intergenic
1029323861 7:99788871-99788893 AGATGAGCAAACTAAGCCACAGG + Intergenic
1032158947 7:129495430-129495452 AGGTCAGCAAACTCTGTGAAGGG - Intergenic
1038818545 8:30931382-30931404 AGGTGTGCAAACACTTCCAGGGG - Intergenic
1039418354 8:37414889-37414911 AGATGAGTAAACTTAGCCACAGG - Intergenic
1041011605 8:53549360-53549382 AGGAGAGCAAACTCTGGGAGGGG - Intergenic
1041929615 8:63272468-63272490 AGGTGAGGAAACTCAGACTCAGG - Intergenic
1045856368 8:106769801-106769823 ACGTGAGCCACCTCAGCCACAGG - Exonic
1047330859 8:123885609-123885631 AGATGAGGAAACTGAGCCACAGG + Intronic
1047797482 8:128272899-128272921 AGGTGAGGAAACTGAGGCACAGG + Intergenic
1047803349 8:128332727-128332749 ACATGAGCCAACTCTGCCCCAGG - Intergenic
1047982671 8:130199121-130199143 AAGTGAGCCTATTCTGCCACTGG - Intronic
1048269995 8:133020862-133020884 ACGTGAGCAAACACTGCCTGAGG - Intronic
1050546907 9:6716840-6716862 AAGTAAGCAAACTCACCCACTGG - Intergenic
1052682524 9:31711851-31711873 AGGTGAGGAAACTGAGCCCCAGG - Intergenic
1055941779 9:81657215-81657237 AGCTGAGCAAACTCTGATAAAGG - Intronic
1056947853 9:91015068-91015090 AGATGAGAAAACTGAGCCACAGG - Intergenic
1057380010 9:94559151-94559173 AGGTGAGTAAACTCTGCAAGTGG + Intronic
1058621084 9:106883829-106883851 TGGTGAGCAAACTCTACACCAGG + Intronic
1060816322 9:126637370-126637392 AGGTGGGCACCCTCAGCCACAGG - Intronic
1061453066 9:130678995-130679017 AGGTGAGGAAACTGAGGCACAGG - Intronic
1062432991 9:136534247-136534269 TGCTGAACAAACTCTTCCACAGG - Intronic
1185495052 X:548253-548275 AGGTGAGCAAACACTTTCCCTGG - Intergenic
1187672208 X:21679090-21679112 AGGTGAGAAAACTCTGTGGCTGG + Intergenic
1187709978 X:22043472-22043494 AGGTGAGGAAACTAAGACACAGG + Intronic
1189393459 X:40598334-40598356 AAGTGAGCAAACTGGGCCAATGG + Intronic
1189487971 X:41447215-41447237 ATGTCAGCAAAATCTGTCACTGG + Intergenic
1189561290 X:42193872-42193894 AGGTGACCAATCCCTCCCACTGG + Intergenic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1200775779 Y:7168888-7168910 GGGTGAGCTAGCTCTTCCACGGG - Intergenic
1201371714 Y:13271549-13271571 AGGTGAGGAAACTCAGGCCCAGG - Intronic