ID: 914478924

View in Genome Browser
Species Human (GRCh38)
Location 1:148048071-148048093
Sequence TCCTATCCCCAGGATGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914478924_914478932 21 Left 914478924 1:148048071-148048093 CCAGGCCCATCCTGGGGATAGGA No data
Right 914478932 1:148048115-148048137 AACAATGAAAAAATTAAGGTTGG No data
914478924_914478931 17 Left 914478924 1:148048071-148048093 CCAGGCCCATCCTGGGGATAGGA No data
Right 914478931 1:148048111-148048133 TATTAACAATGAAAAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914478924 Original CRISPR TCCTATCCCCAGGATGGGCC TGG (reversed) Intergenic
No off target data available for this crispr