ID: 914478932

View in Genome Browser
Species Human (GRCh38)
Location 1:148048115-148048137
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914478919_914478932 30 Left 914478919 1:148048062-148048084 CCAGTAAATCCAGGCCCATCCTG No data
Right 914478932 1:148048115-148048137 AACAATGAAAAAATTAAGGTTGG No data
914478927_914478932 11 Left 914478927 1:148048081-148048103 CCTGGGGATAGGATATCTCTCTA No data
Right 914478932 1:148048115-148048137 AACAATGAAAAAATTAAGGTTGG No data
914478924_914478932 21 Left 914478924 1:148048071-148048093 CCAGGCCCATCCTGGGGATAGGA No data
Right 914478932 1:148048115-148048137 AACAATGAAAAAATTAAGGTTGG No data
914478925_914478932 16 Left 914478925 1:148048076-148048098 CCCATCCTGGGGATAGGATATCT No data
Right 914478932 1:148048115-148048137 AACAATGAAAAAATTAAGGTTGG No data
914478926_914478932 15 Left 914478926 1:148048077-148048099 CCATCCTGGGGATAGGATATCTC No data
Right 914478932 1:148048115-148048137 AACAATGAAAAAATTAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type